ID: 1057367129

View in Genome Browser
Species Human (GRCh38)
Location 9:94433092-94433114
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057367129_1057367139 30 Left 1057367129 9:94433092-94433114 CCTTCCTGCAGCCCTTGAGACGG 0: 2
1: 0
2: 0
3: 15
4: 195
Right 1057367139 9:94433145-94433167 GCCGTGCAGGCCAGGCCATGTGG 0: 1
1: 1
2: 2
3: 30
4: 211
1057367129_1057367135 -7 Left 1057367129 9:94433092-94433114 CCTTCCTGCAGCCCTTGAGACGG 0: 2
1: 0
2: 0
3: 15
4: 195
Right 1057367135 9:94433108-94433130 GAGACGGTACACAATGCGCAGGG 0: 2
1: 0
2: 1
3: 0
4: 27
1057367129_1057367134 -8 Left 1057367129 9:94433092-94433114 CCTTCCTGCAGCCCTTGAGACGG 0: 2
1: 0
2: 0
3: 15
4: 195
Right 1057367134 9:94433107-94433129 TGAGACGGTACACAATGCGCAGG 0: 2
1: 0
2: 0
3: 4
4: 18
1057367129_1057367138 22 Left 1057367129 9:94433092-94433114 CCTTCCTGCAGCCCTTGAGACGG 0: 2
1: 0
2: 0
3: 15
4: 195
Right 1057367138 9:94433137-94433159 AGCAGCTTGCCGTGCAGGCCAGG 0: 1
1: 1
2: 3
3: 16
4: 191
1057367129_1057367137 17 Left 1057367129 9:94433092-94433114 CCTTCCTGCAGCCCTTGAGACGG 0: 2
1: 0
2: 0
3: 15
4: 195
Right 1057367137 9:94433132-94433154 CACTGAGCAGCTTGCCGTGCAGG 0: 1
1: 1
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057367129 Original CRISPR CCGTCTCAAGGGCTGCAGGA AGG (reversed) Intronic
900426957 1:2585359-2585381 CCGTCTCAGGCTGTGCAGGAGGG - Intergenic
901935225 1:12621945-12621967 CCTGCTCAAGAGCTGGAGGAAGG - Intergenic
902520590 1:17013439-17013461 CAGCCTCCAGGGCAGCAGGAAGG + Intergenic
903161455 1:21491979-21492001 CACTCTCAAGGGGTGCAGCAGGG - Intergenic
904756696 1:32771981-32772003 CCGACTCAAGGCCTGCAGCCTGG + Exonic
905502291 1:38449330-38449352 CCCTCTGAAGGGCTGCTGGGTGG - Intergenic
906048003 1:42847228-42847250 CCAAGTCAAGGGCTGCAGGGAGG - Intronic
907536164 1:55160439-55160461 CTGTCTCAAGAGTTGCAGTAAGG - Intronic
910427643 1:87132447-87132469 CCGCCTCCAGGGGTGAAGGACGG - Intronic
912418959 1:109530688-109530710 CCCTCCCAAGGGCCGCTGGAGGG - Intergenic
912449409 1:109760046-109760068 GAGTCTGAGGGGCTGCAGGAGGG + Intronic
912547080 1:110458506-110458528 GCGACTCAAGGGCTGCAAGAAGG - Intergenic
915919591 1:159964411-159964433 CTGTCTCAAGGACTGCCGCAGGG + Intergenic
918045888 1:180940950-180940972 CCATCTCAAGGGCCGCAGATGGG - Intronic
919774752 1:201187246-201187268 CTGGCGCAAGGGCTACAGGAGGG - Intergenic
919785507 1:201255548-201255570 CCCTGCCAAGGGCTGCAGGGTGG - Intergenic
920850743 1:209626569-209626591 CCATCTCCAGGGCAGCAGCAAGG - Intronic
922324124 1:224512733-224512755 CCACCTCAGGGGCTGGAGGAAGG - Intronic
922531734 1:226350128-226350150 TCGCCTCCAGGGCTGCAGCATGG + Intergenic
922801602 1:228367180-228367202 CCGTCTCAGGGGCTGAGGGCAGG - Intronic
1063131471 10:3181546-3181568 CCGTATCAGGGGATGGAGGAAGG + Intergenic
1064426535 10:15234614-15234636 CAGTCTGATTGGCTGCAGGAGGG + Intronic
1067568144 10:47352648-47352670 CCCTCTCTAAGGCTGCTGGAGGG - Intronic
1073135424 10:101217596-101217618 TCGTCTCCAGGTCTCCAGGATGG - Intergenic
1074578761 10:114696187-114696209 CCCTCTCCAGGGATGGAGGAGGG - Intergenic
1076527510 10:131121622-131121644 CCGTCTGCAGGGCTGCAGCTGGG - Intronic
1076527542 10:131121771-131121793 CCGTCTGCAGGGCTGCAGCTGGG - Intronic
1077545477 11:3167475-3167497 CCTGCTCAAGGGCTCCTGGATGG - Intergenic
1079073990 11:17372126-17372148 CCGTCTTACCAGCTGCAGGATGG + Exonic
1084771127 11:71343553-71343575 CCGTGTCAGGGGCCGCAGGGAGG - Intergenic
1088724158 11:112619757-112619779 CCATCTCCATGGATGCAGGAGGG + Intergenic
1089537496 11:119169467-119169489 CCGTCCCAGGGGCTGCGGAAGGG - Intronic
1089579116 11:119470519-119470541 CCGTCTTAAGGCTTGCGGGAAGG - Intergenic
1089868261 11:121650764-121650786 ATCTGTCAAGGGCTGCAGGAAGG - Intergenic
1090247056 11:125224143-125224165 CCCTCTGTTGGGCTGCAGGAAGG - Intronic
1091917506 12:4280501-4280523 CCGCCCCCAGGGCTGCAGGAAGG - Intronic
1092187830 12:6493937-6493959 AAATCTCAACGGCTGCAGGACGG - Exonic
1093281661 12:17203582-17203604 CCATCTCACTGGCTGCAGCAGGG + Intergenic
1094071344 12:26417479-26417501 CCGTCTCAAGAACAGCATGAGGG - Intronic
1097193790 12:57232933-57232955 GAGTCTTAAGGGCTGCAGGTGGG - Intronic
1100524674 12:95408180-95408202 TCTTATCAAGGTCTGCAGGAGGG + Intergenic
1105478420 13:20749473-20749495 ACTTCTCAAGAGCTGCAGGAGGG - Intronic
1106760331 13:32861433-32861455 CCAGCTCTAGGGCTGAAGGAAGG + Intergenic
1106836996 13:33645223-33645245 AGGTCTCAGGGCCTGCAGGAGGG - Intergenic
1106982316 13:35302033-35302055 GCGCCTCATGGGCTGCAGTAGGG + Intronic
1109934176 13:69259502-69259524 CAGCCCCAAGGGCTGCAGGTTGG - Intergenic
1114059126 14:19002777-19002799 CCATATAAAGGGCTGCAGTATGG - Intergenic
1114103417 14:19398977-19398999 CCATATAAAGGGCTGCAGTATGG + Intergenic
1114536671 14:23427296-23427318 CCTTCTCAATAGCTGCAGGAAGG + Exonic
1117011132 14:51471895-51471917 CCTTATAAAGGGCTGGAGGAGGG + Intergenic
1122153498 14:99737217-99737239 CTGTCTCCAAGGCTGCAGGAAGG - Intergenic
1122645332 14:103189768-103189790 CCGTCTCCAGGGCTTCAGGTTGG + Intergenic
1122649766 14:103220184-103220206 CCATCTCCAGGGCTTCAGGTTGG - Intergenic
1122938095 14:104969144-104969166 CTGCCTCCAAGGCTGCAGGAGGG + Intronic
1202836394 14_GL000009v2_random:80313-80335 CCATATAAAGGGCTGCAGTATGG - Intergenic
1123496686 15:20833858-20833880 CCATATAAAGGGCTGCAGTATGG + Intergenic
1123499574 15:20867379-20867401 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1123553922 15:21407450-21407472 CCATATAAAGGGCTGCAGTATGG + Intergenic
1123556826 15:21441109-21441131 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1123590165 15:21844815-21844837 CCATATAAAGGGCTGCAGTATGG + Intergenic
1123593049 15:21878345-21878367 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1124353641 15:28978753-28978775 TCTTCTCCAGGACTGCAGGAGGG + Intronic
1125733728 15:41909255-41909277 CAGGCTCAAGGGCTCCAGCAGGG - Intronic
1128678628 15:69629985-69630007 CCCTCAGAAGGGCTGCAGGTGGG - Intergenic
1128811416 15:70575575-70575597 CTTTCTCAAGGGCTGTAGCAAGG + Intergenic
1128932688 15:71719710-71719732 CCGTCTCCCGGGCTGGAGTACGG + Intronic
1129412284 15:75356561-75356583 AGGTGTCTAGGGCTGCAGGAAGG + Exonic
1131265096 15:90911010-90911032 CCATCCCAAGAGCTGCTGGATGG + Intronic
1131513939 15:93065373-93065395 CCTTATCAAGGGTTGAAGGAAGG - Intronic
1202962268 15_KI270727v1_random:134646-134668 CCATATAAAGGGCTGCAGTATGG + Intergenic
1202965169 15_KI270727v1_random:168298-168320 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1132595255 16:746212-746234 GGGTCTGCAGGGCTGCAGGAGGG + Intronic
1132595300 16:746387-746409 GGGTCTGCAGGGCTGCAGGAGGG + Intronic
1133271651 16:4613546-4613568 CCATCCCAGGGCCTGCAGGAGGG - Intronic
1134009137 16:10838401-10838423 CCGTCTCCAGGCCTTTAGGATGG + Intergenic
1136008766 16:27348763-27348785 CTGCCTCTAGGGCTGCAGGTGGG + Intronic
1136088581 16:27902793-27902815 CCGCCTTAAGGGCTGCAGTGAGG + Intronic
1138082366 16:54102757-54102779 CCTTCTCCAAGGCAGCAGGATGG + Intronic
1138201985 16:55095876-55095898 CGGTTTCAAGAGCTGCAAGAAGG - Intergenic
1139528132 16:67528929-67528951 CCGTTTCCGGGGCTGCAGGCCGG + Intronic
1141698035 16:85629497-85629519 CCTGCTCCAGGGCCGCAGGAGGG - Intronic
1142084008 16:88166562-88166584 TTGCCTCAAGGGGTGCAGGAGGG - Intergenic
1142559046 17:799117-799139 CGGTGGCCAGGGCTGCAGGAGGG + Intergenic
1143491614 17:7288464-7288486 CCTTATCAAGGGTTGAAGGAAGG - Exonic
1145776470 17:27532445-27532467 CAGTCTCAAGTGCTGCGGGCTGG - Intronic
1146761398 17:35482360-35482382 CCATCACAAAGGCTGCAGCAGGG + Intronic
1146815137 17:35936474-35936496 CCCACTCAAGGGCTGCAGCTGGG - Intronic
1148450528 17:47774848-47774870 GAGTCTAAAGGGCTGAAGGAGGG - Intergenic
1148784702 17:50140407-50140429 CCTTCCCAAGGGAGGCAGGAAGG + Intronic
1148846646 17:50533653-50533675 TCTTCTCAGGGCCTGCAGGATGG - Intronic
1149547052 17:57511451-57511473 CAGTCTCAAGGCACGCAGGAAGG - Intronic
1151049419 17:70960060-70960082 CCATTTCAAGGGCTGCTGGGTGG + Intergenic
1151970450 17:77454905-77454927 CCGACTCCGGGGCTGCGGGAAGG + Intronic
1152175087 17:78782117-78782139 CCGCCGCAAGCGCTGCCGGACGG + Intronic
1154213529 18:12399228-12399250 CCATCTCAATGCCAGCAGGAGGG - Intergenic
1154454597 18:14509542-14509564 CCATATAAAGGGCTGCAGTATGG + Intronic
1154457633 18:14544254-14544276 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1156078153 18:33305451-33305473 CCCTCTCAAGGACTCCAGCAGGG - Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1158198201 18:54911051-54911073 CCATCTCACTGGCTGCAGCAGGG - Intronic
1158215535 18:55097079-55097101 CAGTTTCAAGGGCTGAAGTAGGG + Intergenic
1159543601 18:69812793-69812815 TCTTCACAAGGGCAGCAGGAAGG + Intronic
1161593955 19:5141870-5141892 GCGCCTCCAGGGCAGCAGGAGGG + Intronic
1163442117 19:17327566-17327588 CCTTCTGCAGGGCGGCAGGAGGG + Exonic
1166856560 19:45785317-45785339 CCGTCTGAAGGGCAGCAGATGGG - Intronic
1167049091 19:47067790-47067812 CTGCCTCAAGGTCTTCAGGATGG + Exonic
1167465184 19:49646799-49646821 CCGTCTCAGGGCCTGGAGGACGG + Exonic
1202636245 1_KI270706v1_random:47052-47074 CCATATAAAGGGCTGCAGTACGG + Intergenic
926799797 2:16650095-16650117 ACGTGTCAGGGGCTGCAGGTTGG - Intronic
929492242 2:42407457-42407479 CCATCACACTGGCTGCAGGAGGG + Intronic
929847059 2:45541370-45541392 CCTTCTCAAGGTCTGCAGCATGG + Intronic
929869344 2:45745212-45745234 CTGTCTCAGTCGCTGCAGGAAGG - Intronic
930062070 2:47298374-47298396 CAGTCCCAAGGGCTGCTGGTTGG - Intergenic
931239482 2:60439489-60439511 CTGACTCAAGGGTGGCAGGAAGG + Intergenic
931929630 2:67116044-67116066 CCATCTCAATAGATGCAGGAAGG + Intergenic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935147371 2:100405067-100405089 CCGGCTCTAGGGCTTCAGGAGGG + Intronic
936525236 2:113236770-113236792 CAGGCTCAGGGTCTGCAGGAAGG - Intronic
937352443 2:121174866-121174888 CTGTCTCACGTGCTGAAGGAAGG - Intergenic
937855997 2:126672344-126672366 CCATTTCAGGGACTGCAGGAGGG - Intronic
937905781 2:127052195-127052217 CAGTCTCTAGGGGTGCAGCATGG - Intronic
938477596 2:131630037-131630059 CCATATAAAGGGCTGCAGTATGG - Intergenic
942900908 2:181117358-181117380 CAGTCTCAAGGCCAGCTGGAAGG + Intergenic
944260162 2:197668092-197668114 CAGTCTCTAGGCCTGCAGGTGGG + Intronic
948113594 2:235477027-235477049 CCATCTCCTGGGCTGCAGGCAGG - Intergenic
949027782 2:241774453-241774475 CCGGGTCCGGGGCTGCAGGAAGG - Intergenic
1169212157 20:3772622-3772644 CAGTCCCAAGAGCTGCAGGTTGG + Intergenic
1171882377 20:30627991-30628013 CCATATAAAGGGCTGCAGTATGG + Intergenic
1172035948 20:32010791-32010813 CTGTCTGAGAGGCTGCAGGAGGG - Intronic
1173113477 20:40218043-40218065 CGGTCTCAAGGCCTTAAGGAAGG + Intergenic
1173524629 20:43722095-43722117 CCATCACATGGGCTGCAGCAGGG - Intergenic
1173863114 20:46297179-46297201 GCTGCTCAAGGGCTCCAGGAGGG + Intronic
1174089822 20:48037993-48038015 CTGCCTTAGGGGCTGCAGGAGGG - Intergenic
1175216322 20:57393211-57393233 ACGTCTCAAGGGCTGCACACAGG - Intronic
1176207581 20:63897903-63897925 CCATCTTCAGGGATGCAGGAAGG - Intronic
1176819571 21:13643766-13643788 CCATATAAAGGGCTGCAGTATGG - Intergenic
1180364603 22:11927155-11927177 CCATATAAAGGGCTGCAGTATGG + Intergenic
1180477608 22:15725393-15725415 CCATATAAAGGGCTGCAGTATGG - Intergenic
1180606991 22:17066307-17066329 CCATCTGGAGAGCTGCAGGATGG + Intergenic
1184430945 22:44441324-44441346 CCTCCTCAAGGGCAGGAGGAAGG + Intergenic
1184675392 22:46039190-46039212 CCATCTCAAGTGCTCCAGGAAGG + Intergenic
1185367104 22:50441761-50441783 CCGTCCCCAGGGCCACAGGAAGG + Intronic
952512025 3:34067705-34067727 TCTTGGCAAGGGCTGCAGGAGGG - Intergenic
953793909 3:45968287-45968309 CTGTGCCAAGGGCTGCAGCATGG + Exonic
956060319 3:65342191-65342213 CTGTGTCCAGGGCTGCAGAAAGG + Intergenic
961857604 3:129888362-129888384 CCCTCTCAAGGGACGGAGGAAGG - Intronic
962707503 3:138059530-138059552 CCATCTCAAGGGCTGCTGTGAGG + Intergenic
962716706 3:138132871-138132893 CAGTCACAGTGGCTGCAGGAAGG + Intergenic
963383599 3:144562061-144562083 CTGTCTCAAGGGCTCGAGCATGG - Intergenic
965176579 3:165343007-165343029 CAGCCTCAAGGGCTGCTGGTTGG - Intergenic
968062692 3:195738431-195738453 CCCTCTCAAGGGATGAAGGCAGG - Intronic
968957819 4:3728118-3728140 CCGTCTGCAGGCCTGGAGGAGGG + Intergenic
969030142 4:4205243-4205265 CTGCCTCAAGGACTGAAGGAAGG - Intronic
969277192 4:6143925-6143947 CAGTCTCCAGGGCTGGAGCAGGG + Intronic
969579173 4:8054064-8054086 CAGTCCCACGGGCTGCAGGATGG - Intronic
969655588 4:8495960-8495982 CCATCTGATTGGCTGCAGGAGGG - Intergenic
970015631 4:11509666-11509688 CCATTCCAAGGGCTGCAAGAGGG + Intergenic
973366047 4:49210438-49210460 CCATATAAAGGGCTGCAGCATGG + Intergenic
973394551 4:49582013-49582035 CCATATAAAGGGCTGCAGTATGG - Intergenic
975645653 4:76543228-76543250 CAGTTTCAGGGGCTTCAGGAGGG + Intronic
1202763560 4_GL000008v2_random:132919-132941 CCATATAAAGGGCTGCAGTATGG + Intergenic
989225216 5:39019722-39019744 CCGATTCATGGGCTGCAGAATGG - Intronic
998386318 5:141759013-141759035 CTGTCTGAGGGGCTGCAGGCTGG - Intergenic
1001333317 5:170777546-170777568 CTCTCTCAGGGGTTGCAGGAAGG - Intronic
1001961951 5:175884750-175884772 CCCTCTAAAGGCCTACAGGAAGG + Intergenic
1002473126 5:179449278-179449300 CCATCTCCTGGGCTGCAGCACGG - Intergenic
1002481098 5:179501376-179501398 CCATCTCCTGGGCTGCAGCACGG + Intergenic
1002643051 5:180639758-180639780 CCTTCTTCAGGGCTGCAGGTGGG - Intronic
1002688867 5:181036883-181036905 CCATCACAGGGGCTGCAGCAGGG + Intergenic
1002705628 5:181159688-181159710 CCTTGCCAAGGGCAGCAGGAGGG - Intergenic
1002857445 6:1050761-1050783 CCTCCTCAGAGGCTGCAGGATGG + Intergenic
1006256632 6:32837852-32837874 CCTTCTCCTGGGCTCCAGGAGGG + Exonic
1006388162 6:33743618-33743640 ATGACTCAAGGGCTGTAGGATGG + Intronic
1014018650 6:116564007-116564029 CCGGCTCCAGGGCTGCAGGTGGG - Intergenic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1019282794 7:208887-208909 CCGACTTCATGGCTGCAGGAAGG - Exonic
1019644283 7:2120834-2120856 CCGTTTCCAAGGCTGCAGGCAGG + Intronic
1019999877 7:4749597-4749619 GTGTCTCTAGGGCTTCAGGAGGG + Intronic
1020000894 7:4754901-4754923 CCTGCTCAAGGGCTGTATGAAGG - Intronic
1022355705 7:29612484-29612506 CGCCCTCATGGGCTGCAGGATGG + Intergenic
1024237287 7:47408162-47408184 CACTCCCAAGGGCTGCAGGTGGG + Intronic
1025190731 7:56893642-56893664 CTGTCCCAAGGCCAGCAGGAGGG + Intergenic
1025681212 7:63683282-63683304 CTGTCCCAAGGCCAGCAGGAGGG - Intergenic
1029421576 7:100474583-100474605 CCTTCTCCAGAGCTGGAGGAGGG - Intronic
1034265258 7:149777627-149777649 CCCTGCCAGGGGCTGCAGGAGGG - Intergenic
1036617948 8:10403422-10403444 CCTTCTCCAGGGCCACAGGAAGG + Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1039596988 8:38799113-38799135 CTGAATCAAGGGCTTCAGGAGGG - Intronic
1042669668 8:71247248-71247270 CCTCCTCTAGGGCTGCTGGAAGG - Intronic
1042755131 8:72202145-72202167 CCTTCTCACAGGCAGCAGGAAGG - Intergenic
1045224578 8:100232003-100232025 CCTTCTGAAGTGCTGCGGGAAGG + Intronic
1049368637 8:142253022-142253044 CCCTCCCCAGGCCTGCAGGAGGG + Intronic
1049556020 8:143282588-143282610 CCGTCACCAGGGATGCAGCAGGG + Intergenic
1049725555 8:144144077-144144099 CCATTTCAAGGGCTGCAGCCAGG + Intergenic
1053363618 9:37507537-37507559 CTGACTCCAGGGCTGCAGCAGGG - Intergenic
1057367129 9:94433092-94433114 CCGTCTCAAGGGCTGCAGGAAGG - Intronic
1057656207 9:96954978-96955000 CCGTCTCAAGGGCTGCAGGAAGG + Intronic
1058758927 9:108110563-108110585 CTGTCTCACGAGCTGCAAGATGG + Intergenic
1059453237 9:114383802-114383824 ACTTCTCAAGGGCTGGAGGAGGG + Intronic
1060236126 9:121863915-121863937 CCCAGTCCAGGGCTGCAGGAGGG + Intronic
1061647807 9:132019912-132019934 ACGTCTCAGCGCCTGCAGGAGGG - Intronic
1061895250 9:133643668-133643690 CCGTCTCAGAGGCTTCAAGAAGG + Intronic
1062006155 9:134239535-134239557 CCGTCGCAAGGCCGGCAGGGAGG - Intergenic
1062381598 9:136289586-136289608 CCCCCACAAGGGCTGCAGGAGGG + Intronic
1203781666 EBV:104432-104454 GCGTCTCAAGGTCTGGAGGACGG - Intergenic
1203527788 Un_GL000213v1:105804-105826 CCATATAAAGGGCTGCAGTATGG + Intergenic
1203544315 Un_KI270743v1:117792-117814 CCATATAAAGGGCTGCAGTATGG + Intergenic
1190535304 X:51420812-51420834 CAGTCTCAAGTACTGCTGGAGGG - Intergenic
1192259240 X:69494365-69494387 AAGTCTCTAGGCCTGCAGGAAGG - Intergenic
1196161932 X:112494821-112494843 CAGTCCCAAGGGCTGCAGTTTGG + Intergenic