ID: 1057367536

View in Genome Browser
Species Human (GRCh38)
Location 9:94437074-94437096
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057367536_1057367540 7 Left 1057367536 9:94437074-94437096 CCAGGCTCCAAGTGTGGGATGGA 0: 2
1: 0
2: 1
3: 13
4: 157
Right 1057367540 9:94437104-94437126 GCAAAGGCCTGTTGGCACGCAGG 0: 2
1: 0
2: 0
3: 4
4: 101
1057367536_1057367539 -1 Left 1057367536 9:94437074-94437096 CCAGGCTCCAAGTGTGGGATGGA 0: 2
1: 0
2: 1
3: 13
4: 157
Right 1057367539 9:94437096-94437118 ATGTGCGTGCAAAGGCCTGTTGG 0: 2
1: 0
2: 2
3: 17
4: 106
1057367536_1057367538 -9 Left 1057367536 9:94437074-94437096 CCAGGCTCCAAGTGTGGGATGGA 0: 2
1: 0
2: 1
3: 13
4: 157
Right 1057367538 9:94437088-94437110 TGGGATGGATGTGCGTGCAAAGG 0: 2
1: 0
2: 0
3: 9
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057367536 Original CRISPR TCCATCCCACACTTGGAGCC TGG (reversed) Intronic
900420772 1:2555084-2555106 CCCACCCCACAGCTGGAGCCTGG - Intergenic
901116244 1:6847230-6847252 TCCATCCTTCACTTGAGGCCAGG - Intronic
902716317 1:18275400-18275422 CCCGTCCCATTCTTGGAGCCTGG + Intronic
903633016 1:24791263-24791285 AGCATCCTACACTGGGAGCCAGG - Intronic
904594677 1:31635826-31635848 TCCATTCTACACTGGGAGCTGGG - Intronic
905851422 1:41277761-41277783 TCTCTCCCACACCTGGGGCCGGG - Intergenic
906710686 1:47927528-47927550 TCTGTCCCTCACTTGCAGCCTGG - Intronic
906847145 1:49205493-49205515 TCCATCCTACCCCTGGACCCTGG + Intronic
915144874 1:153790540-153790562 TCCATCCCAGGGATGGAGCCCGG - Intergenic
922421840 1:225465710-225465732 TCCTTCCTACTCTGGGAGCCTGG - Intergenic
1064168648 10:13008425-13008447 TCCACATCACACTTGGAGTCTGG - Intronic
1064324218 10:14333588-14333610 TCCATCCCACACACTGAGGCAGG - Intronic
1068422932 10:56820589-56820611 TTCATCCCATACTTGGGTCCAGG - Intergenic
1070223289 10:74473813-74473835 TCCACCCCACACTTGGGGGTGGG + Intronic
1071842068 10:89482923-89482945 TTCATGTCACACCTGGAGCCCGG - Intronic
1073300919 10:102470576-102470598 TCCATCCCTCCCCTGGGGCCTGG + Intronic
1074592482 10:114826167-114826189 TGTTTCCCTCACTTGGAGCCAGG - Intronic
1076995322 11:294835-294857 GCCATCCCTCACCTGCAGCCAGG + Exonic
1077416132 11:2425115-2425137 TCCAGCCCCCACCTGGGGCCTGG - Intergenic
1083266995 11:61551354-61551376 CCCATCCCAAACTAGCAGCCTGG + Intronic
1083290715 11:61688602-61688624 TCCCTCCCACTCTGGGCGCCTGG + Intronic
1084874011 11:72117338-72117360 TCCATCCCAAACTCAGAGTCAGG - Intronic
1089443668 11:118534894-118534916 GCCATGCCACACTTGGATGCTGG - Exonic
1090584014 11:128190659-128190681 GCCATCCAACAATTGAAGCCTGG + Intergenic
1092246486 12:6867127-6867149 TCTATCCCACAGTTGGAGAGGGG + Exonic
1096513311 12:52143722-52143744 CCCCACCCCCACTTGGAGCCAGG - Intergenic
1096559568 12:52425762-52425784 TCCCTCTGAAACTTGGAGCCTGG - Intronic
1099649534 12:85407136-85407158 TCCATCCCACACTCATACCCAGG + Intergenic
1104902707 12:132197874-132197896 TCCACCAGACACTTGGAGTCAGG + Exonic
1106606156 13:31231214-31231236 TCCATCCCTCAGGTGGATCCAGG + Intronic
1113483319 13:110637410-110637432 TCCACCCCACACTTGGGCCTGGG + Intronic
1114658303 14:24329288-24329310 TCCACCCCCCACTAGGACCCAGG + Intronic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1119698163 14:76730635-76730657 TCCATGCCACACTTGGGGCAAGG - Intergenic
1121665102 14:95666215-95666237 TGCCTCCCATGCTTGGAGCCAGG + Intergenic
1122790397 14:104181902-104181924 ACCATCCCCCGCCTGGAGCCAGG - Intergenic
1123945349 15:25236307-25236329 CCAATCCCACACAGGGAGCCTGG - Intergenic
1124223522 15:27870050-27870072 TGCATCCCTCGCTTGCAGCCTGG - Intronic
1126306684 15:47266594-47266616 TCCATCCCACAAATAGAGGCTGG + Intronic
1126668892 15:51098220-51098242 TCCATCCCACAAGAGGAGACAGG - Intronic
1128745603 15:70111934-70111956 TCCATCCCTCCCTAGGAACCAGG + Intergenic
1129167107 15:73784879-73784901 TTCATACCACACTGGGATCCTGG + Intergenic
1129677979 15:77642663-77642685 TCCATACCACACAGGGAGCAAGG + Intronic
1131708853 15:95030518-95030540 TCCATCCCACACATAGACCCTGG - Intergenic
1133164376 16:3936172-3936194 TCCTTCCCACACTTGTGCCCAGG - Intergenic
1135597516 16:23755302-23755324 TCCTCCCCAGACTTGGAGGCTGG - Intronic
1135974519 16:27099125-27099147 TCTATGCCAGACTTTGAGCCAGG + Intergenic
1136289419 16:29262402-29262424 CCCCCCACACACTTGGAGCCCGG + Intergenic
1138100349 16:54247075-54247097 TCTGACCCACCCTTGGAGCCAGG - Intronic
1139366645 16:66437720-66437742 TCCTTCCACCACTTGGGGCCAGG + Intronic
1140122253 16:72093837-72093859 ACCGTTCCACACTTGGATCCAGG + Exonic
1140238465 16:73180167-73180189 TCCAGCCAACTCTTGGACCCAGG + Intergenic
1140821121 16:78664299-78664321 GCCAGCCCACACTGGGAGTCAGG - Intronic
1142155913 16:88532872-88532894 TAGATCTCACCCTTGGAGCCAGG - Exonic
1142877533 17:2861039-2861061 TCCTTTCCACACTTGGAACATGG + Intronic
1143491752 17:7289271-7289293 CCCATCCCCCACTTGCTGCCTGG - Intronic
1146054396 17:29573942-29573964 TCCCTTCCCCACCTGGAGCCAGG - Exonic
1146637185 17:34515051-34515073 TCCATCCAACTCCTGCAGCCAGG + Intergenic
1146689876 17:34866047-34866069 TCCAGCCCACACTCAGAGACAGG + Intergenic
1146737198 17:35248663-35248685 TCCATCCCTCTCTTTAAGCCAGG + Intronic
1151054917 17:71019822-71019844 TCCACCCCACACTTGGAGAAAGG - Intergenic
1151680652 17:75621033-75621055 CCCTGCCCACCCTTGGAGCCAGG + Intergenic
1152041765 17:77908076-77908098 CCCATCCCACCCTAGGACCCGGG + Intergenic
1152226801 17:79096528-79096550 CCCATCCCACCCTTGAAGCCAGG - Intronic
1152800922 17:82330288-82330310 TCCTGCCCTCACCTGGAGCCTGG + Intronic
1155540998 18:26868115-26868137 TCCAACTCTCACTTGGATCCAGG - Intergenic
1156996057 18:43468229-43468251 TCCATCGGATACTTAGAGCCTGG - Intergenic
1158511938 18:58098259-58098281 TCCCTCCCACACCTGCAGGCTGG - Intronic
1160332637 18:78009358-78009380 GACTTCCCACACATGGAGCCAGG + Intergenic
1160401968 18:78618097-78618119 TACAGCCCACACTTGGTCCCTGG - Intergenic
1160946453 19:1646107-1646129 TCCCTCCCGCGCCTGGAGCCTGG - Intronic
1161061225 19:2216161-2216183 TCCATCCCACACAAGCAGCGGGG + Intronic
1161077177 19:2291490-2291512 GCCATCGCGCACGTGGAGCCCGG - Exonic
1161316555 19:3620081-3620103 TCCGACCCAGACTTGGAGCCAGG - Intronic
1161661064 19:5546586-5546608 TCCATCCCACAGTCCCAGCCTGG - Intergenic
1163528462 19:17835510-17835532 TCCCTTCCACACTTGCACCCTGG + Intronic
1166834555 19:45659319-45659341 TCCACCCCACCCTTGCATCCTGG + Intergenic
1166948351 19:46411144-46411166 TCCCTCCCACACTTGGAGGGAGG + Exonic
1168564132 19:57408967-57408989 TCCATCTAACACTTGGTGACAGG - Intronic
927880554 2:26687288-26687310 CCCTTCCCACACTTGGGGCAGGG - Intergenic
928662821 2:33520767-33520789 TCCATCCCACTCCTGAATCCAGG + Intronic
929888301 2:45898222-45898244 TCCAGCCCACACTAGGAGGGAGG + Intronic
930418286 2:51117717-51117739 TCCATTCCACACTCTGAGGCTGG - Intergenic
930715314 2:54588436-54588458 TCCATCCCACACAGGGAGTGTGG - Intronic
931170897 2:59802799-59802821 TCCCTCACACACTTCCAGCCTGG + Intergenic
932338998 2:70948004-70948026 TCCAGCACACACTTAGAGCCTGG + Intronic
933950708 2:87326868-87326890 CCCTTCCCACTCTGGGAGCCTGG - Intergenic
935696515 2:105775707-105775729 TCCTTCCTACCCTGGGAGCCTGG + Intronic
936919767 2:117676030-117676052 CCCATCCCACACATGCAGCAGGG + Intergenic
943301389 2:186206988-186207010 TCCATCCCAGTCTTGGTGACAGG - Intergenic
943888479 2:193254200-193254222 TCAATCCCTCACTTGAAACCTGG - Intergenic
944159101 2:196639982-196640004 CCCATCCCTCAGCTGGAGCCAGG - Intronic
944534491 2:200695848-200695870 TTCATCCCAGACTTGGCCCCAGG + Intergenic
947748179 2:232520107-232520129 CCCATCCCAGCCCTGGAGCCAGG + Intergenic
948644165 2:239393313-239393335 TCCATCACCCAGCTGGAGCCAGG + Intronic
949069005 2:242012192-242012214 ACCATCCCAAACCTGGAGCTCGG - Intergenic
1170972223 20:21126331-21126353 TCCAGGCCCCACTGGGAGCCTGG - Intronic
1172436946 20:34935747-34935769 TTCAGCCCACAGTGGGAGCCTGG + Intronic
1172848567 20:37944648-37944670 ACCATCCCTCACTTGGACCTGGG + Exonic
1175113028 20:56662397-56662419 TCCCTCCCACACTTGCCCCCAGG + Intergenic
1175683180 20:61006256-61006278 TCCATGCCACAGTTTAAGCCAGG + Intergenic
1176185483 20:63776084-63776106 TCCAGCCCACCCTGGGAGCCGGG + Intronic
1177154908 21:17491738-17491760 TCCCTGCCACACTTGGTCCCTGG - Intergenic
1177379909 21:20326595-20326617 TCCTTCCCACACCTGGATCTTGG + Intergenic
1177871442 21:26577990-26578012 ACCATCCCACACTTGATGCTAGG - Intergenic
1178114265 21:29401168-29401190 TCTATTCCACACTTGGAGCAAGG - Intronic
1179598847 21:42462001-42462023 TCCACCCCACACTTGCTCCCAGG - Intergenic
1180036058 21:45250419-45250441 TCCTTACCACACTGGGTGCCGGG - Intergenic
1181011744 22:20044862-20044884 TCCATCCCACCCTGGCACCCAGG + Intronic
1182124667 22:27807728-27807750 TCCCTCACACGCTTGGAGACAGG - Intergenic
1183345396 22:37304586-37304608 TCCACCCCAGCCTTGGAGGCAGG - Intronic
1183651108 22:39153498-39153520 TCCATTCCTCACTGGGAGCCCGG + Intergenic
1185268574 22:49918081-49918103 TGCACCCCTCACTTGGGGCCGGG - Intronic
949500146 3:4672164-4672186 TCCATTCCACACTGGGAGGTGGG + Intronic
953005649 3:38976759-38976781 TCTCTCCCACACTTGCACCCAGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954240425 3:49289395-49289417 TCCACCCCACACCTTGAGCTGGG + Intronic
954327102 3:49869669-49869691 TGCATCCCGCACCTCGAGCCAGG + Intronic
954406927 3:50350401-50350423 TCCCTGCCACATTGGGAGCCGGG + Intronic
954705665 3:52479285-52479307 TCCCTCCCACATTTGCAGGCGGG + Intronic
954874118 3:53789930-53789952 TCCTTCCCACACATGGATCCAGG - Intronic
955513636 3:59705889-59705911 TGCATCCCAGCGTTGGAGCCAGG - Intergenic
955774060 3:62414952-62414974 TCCTGCCCAGACTTGGAGCTGGG - Intronic
957677736 3:83392716-83392738 TGCATCCTACACTGTGAGCCAGG + Intergenic
957761097 3:84557803-84557825 TTCATGCCAAACTTGGAGCCAGG - Intergenic
958842978 3:99231199-99231221 ATCATCCCACACATGGAACCTGG - Intergenic
960958299 3:123050694-123050716 TCCCTCACACACTTCCAGCCAGG - Intergenic
961773570 3:129267926-129267948 TCCATCACACACCTGCAGCCAGG - Exonic
965247499 3:166292288-166292310 TCCTGACCTCACTTGGAGCCAGG + Intergenic
969577397 4:8044344-8044366 GCCATCCCTCACCTGGCGCCTGG + Intronic
971533476 4:27718606-27718628 TTCATCCCAAACTTGGTGACTGG - Intergenic
973588927 4:52420589-52420611 GCCAGCCCTCACCTGGAGCCTGG - Intergenic
985665714 5:1180698-1180720 TGCATCCCACCCTGGGAGCATGG - Intergenic
989730465 5:44641836-44641858 TCCATCCAAAACTGGCAGCCCGG + Intergenic
998845710 5:146307676-146307698 TCCATCCTACAATTGGTGTCTGG + Intronic
1000008359 5:157208722-157208744 TTTATCCCACACTTAGGGCCAGG + Intronic
1001892301 5:175349828-175349850 TCCATCACAGATTGGGAGCCAGG - Intergenic
1003025079 6:2547619-2547641 TCCGTCTCACACTTGGGGCTTGG + Intergenic
1004273311 6:14213417-14213439 TCCTTCCAACACCTGGAGGCTGG - Intergenic
1005447012 6:25934338-25934360 TTCATACCACACATGGAGACTGG - Intergenic
1006443067 6:34063903-34063925 TCCTTCCCGCTCCTGGAGCCAGG - Intronic
1006577493 6:35057074-35057096 GCAATCCCACACTTGGTGCAGGG - Intronic
1006844665 6:37053990-37054012 GCCCTCCCGCTCTTGGAGCCAGG + Intergenic
1007303425 6:40886192-40886214 TCCATCCACCACTTGTCGCCAGG - Intergenic
1008036823 6:46753771-46753793 TCCAGCCCACACTAGTAACCAGG - Exonic
1008264377 6:49406406-49406428 TGCATAGCACACTTGGAGACAGG + Intergenic
1010734517 6:79428765-79428787 TTTATTCCACTCTTGGAGCCTGG + Intergenic
1022140713 7:27491298-27491320 TCCATCCCAGGCCTGGAGGCTGG - Intergenic
1022771025 7:33473041-33473063 TCCATCCCAGAGCTGGAGCTCGG - Intronic
1024282703 7:47732645-47732667 TCCATCCCTTACTTCTAGCCTGG + Intronic
1024526463 7:50353914-50353936 TTCATGCCACACTGGGACCCAGG + Intronic
1025854307 7:65264568-65264590 CACAGCCCACCCTTGGAGCCAGG + Intergenic
1029341329 7:99947146-99947168 TACATCCTACACTTGTACCCAGG + Intergenic
1038359522 8:26864000-26864022 TCCATCCCGGACTGGGAGTCTGG + Intronic
1039828522 8:41194896-41194918 GCCAGCCCACACTTCCAGCCTGG + Intergenic
1040476300 8:47781116-47781138 TCCATCCCACAAATGCAGGCAGG + Intronic
1044747454 8:95384509-95384531 TCCCTCCCACAGTTGATGCCTGG + Intergenic
1047199351 8:122751727-122751749 TCCATACTTCACTTGGAGCAAGG + Intergenic
1049386367 8:142344951-142344973 TCCCTCCCACACTTGGGCCAGGG + Intronic
1049833981 8:144721231-144721253 TCTGTACCACACTTGGAGGCAGG + Exonic
1051453521 9:17225236-17225258 CCCATCCCACACAATGAGCCTGG + Intronic
1052855410 9:33403462-33403484 CCCTTCCCACCCATGGAGCCTGG - Intergenic
1053425309 9:38006297-38006319 TCCATCCCACACTCCCAGGCGGG + Intronic
1056763348 9:89429618-89429640 TTCATCTCAAGCTTGGAGCCTGG + Intronic
1057367536 9:94437074-94437096 TCCATCCCACACTTGGAGCCTGG - Intronic
1057655792 9:96950979-96951001 TCCATCCCACACTTGGAGCCTGG + Intronic
1058607828 9:106742499-106742521 TCCTTCCCACACTCGAAGGCAGG + Intergenic
1060276783 9:122188533-122188555 TCCATCGTCCACTTGCAGCCAGG + Intronic
1060916139 9:127392116-127392138 TCCAGCCCACACCTGGGGCAGGG + Intronic
1186429444 X:9492176-9492198 TCCTTCCCACATGGGGAGCCAGG - Intronic
1192222846 X:69209150-69209172 TCCTGCCCACAGTTGGACCCAGG + Intergenic
1195954692 X:110317402-110317424 GGCACCCCACACTTGGAGCAGGG - Intronic
1196708460 X:118738161-118738183 TCCTTCCCACAGTTGGACCTTGG + Intronic