ID: 1057375902

View in Genome Browser
Species Human (GRCh38)
Location 9:94522751-94522773
Sequence TAGACAAAGATGGTACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057375902_1057375904 2 Left 1057375902 9:94522751-94522773 CCTGTTTGTACCATCTTTGTCTA No data
Right 1057375904 9:94522776-94522798 TTTTGTATCAGAGTAATACTAGG No data
1057375902_1057375905 19 Left 1057375902 9:94522751-94522773 CCTGTTTGTACCATCTTTGTCTA No data
Right 1057375905 9:94522793-94522815 ACTAGGTTATAAAATGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057375902 Original CRISPR TAGACAAAGATGGTACAAAC AGG (reversed) Intergenic
No off target data available for this crispr