ID: 1057376919

View in Genome Browser
Species Human (GRCh38)
Location 9:94533371-94533393
Sequence TGCTTGTGTAATGATTAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057376919_1057376922 21 Left 1057376919 9:94533371-94533393 CCTAGTTAATCATTACACAAGCA No data
Right 1057376922 9:94533415-94533437 GCTGTCTGCAGTAACTCAGGTGG No data
1057376919_1057376923 22 Left 1057376919 9:94533371-94533393 CCTAGTTAATCATTACACAAGCA No data
Right 1057376923 9:94533416-94533438 CTGTCTGCAGTAACTCAGGTGGG No data
1057376919_1057376921 18 Left 1057376919 9:94533371-94533393 CCTAGTTAATCATTACACAAGCA No data
Right 1057376921 9:94533412-94533434 AATGCTGTCTGCAGTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057376919 Original CRISPR TGCTTGTGTAATGATTAACT AGG (reversed) Intergenic