ID: 1057376921

View in Genome Browser
Species Human (GRCh38)
Location 9:94533412-94533434
Sequence AATGCTGTCTGCAGTAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057376919_1057376921 18 Left 1057376919 9:94533371-94533393 CCTAGTTAATCATTACACAAGCA No data
Right 1057376921 9:94533412-94533434 AATGCTGTCTGCAGTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057376921 Original CRISPR AATGCTGTCTGCAGTAACTC AGG Intergenic
No off target data available for this crispr