ID: 1057376922

View in Genome Browser
Species Human (GRCh38)
Location 9:94533415-94533437
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057376919_1057376922 21 Left 1057376919 9:94533371-94533393 CCTAGTTAATCATTACACAAGCA No data
Right 1057376922 9:94533415-94533437 GCTGTCTGCAGTAACTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057376922 Original CRISPR GCTGTCTGCAGTAACTCAGG TGG Intergenic
No off target data available for this crispr