ID: 1057376923

View in Genome Browser
Species Human (GRCh38)
Location 9:94533416-94533438
Sequence CTGTCTGCAGTAACTCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057376919_1057376923 22 Left 1057376919 9:94533371-94533393 CCTAGTTAATCATTACACAAGCA No data
Right 1057376923 9:94533416-94533438 CTGTCTGCAGTAACTCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057376923 Original CRISPR CTGTCTGCAGTAACTCAGGT GGG Intergenic