ID: 1057376959

View in Genome Browser
Species Human (GRCh38)
Location 9:94533733-94533755
Sequence GCACTTAGTGAGGTCGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057376959_1057376966 2 Left 1057376959 9:94533733-94533755 CCAGCCTCGACCTCACTAAGTGC No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376959_1057376964 -6 Left 1057376959 9:94533733-94533755 CCAGCCTCGACCTCACTAAGTGC No data
Right 1057376964 9:94533750-94533772 AAGTGCTGGGATTACATGTGTGG 0: 11
1: 945
2: 2471
3: 3597
4: 3365
1057376959_1057376968 8 Left 1057376959 9:94533733-94533755 CCAGCCTCGACCTCACTAAGTGC No data
Right 1057376968 9:94533764-94533786 CATGTGTGGGCCACTGGGCCCGG No data
1057376959_1057376965 -5 Left 1057376959 9:94533733-94533755 CCAGCCTCGACCTCACTAAGTGC No data
Right 1057376965 9:94533751-94533773 AGTGCTGGGATTACATGTGTGGG 0: 15
1: 902
2: 2258
3: 3256
4: 2981
1057376959_1057376967 3 Left 1057376959 9:94533733-94533755 CCAGCCTCGACCTCACTAAGTGC No data
Right 1057376967 9:94533759-94533781 GATTACATGTGTGGGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057376959 Original CRISPR GCACTTAGTGAGGTCGAGGC TGG (reversed) Intergenic
No off target data available for this crispr