ID: 1057376966

View in Genome Browser
Species Human (GRCh38)
Location 9:94533758-94533780
Sequence GGATTACATGTGTGGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057376956_1057376966 15 Left 1057376956 9:94533720-94533742 CCCAAGTGATCCGCCAGCCTCGA No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376955_1057376966 16 Left 1057376955 9:94533719-94533741 CCCCAAGTGATCCGCCAGCCTCG No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376957_1057376966 14 Left 1057376957 9:94533721-94533743 CCAAGTGATCCGCCAGCCTCGAC No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376963_1057376966 -8 Left 1057376963 9:94533743-94533765 CCTCACTAAGTGCTGGGATTACA No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376961_1057376966 -2 Left 1057376961 9:94533737-94533759 CCTCGACCTCACTAAGTGCTGGG No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376958_1057376966 5 Left 1057376958 9:94533730-94533752 CCGCCAGCCTCGACCTCACTAAG No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376954_1057376966 21 Left 1057376954 9:94533714-94533736 CCTGACCCCAAGTGATCCGCCAG No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data
1057376959_1057376966 2 Left 1057376959 9:94533733-94533755 CCAGCCTCGACCTCACTAAGTGC No data
Right 1057376966 9:94533758-94533780 GGATTACATGTGTGGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057376966 Original CRISPR GGATTACATGTGTGGGCCAC TGG Intergenic