ID: 1057379155

View in Genome Browser
Species Human (GRCh38)
Location 9:94553550-94553572
Sequence TCCAGCTGGCCAGGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057379148_1057379155 5 Left 1057379148 9:94553522-94553544 CCTTCACTGAAACCGGCTCCTGG No data
Right 1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG No data
1057379150_1057379155 -7 Left 1057379150 9:94553534-94553556 CCGGCTCCTGGCCAAGTCCAGCT No data
Right 1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG No data
1057379146_1057379155 24 Left 1057379146 9:94553503-94553525 CCTGGGCTGGGTGTGAGTGCCTT No data
Right 1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057379155 Original CRISPR TCCAGCTGGCCAGGAATTGC TGG Intergenic
No off target data available for this crispr