ID: 1057385512

View in Genome Browser
Species Human (GRCh38)
Location 9:94602774-94602796
Sequence GACTCACGCCCTCCTAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057385512_1057385519 28 Left 1057385512 9:94602774-94602796 CCATTTCTAGGAGGGCGTGAGTC No data
Right 1057385519 9:94602825-94602847 CTGCAATCCTGAACAAGGCTGGG No data
1057385512_1057385520 29 Left 1057385512 9:94602774-94602796 CCATTTCTAGGAGGGCGTGAGTC No data
Right 1057385520 9:94602826-94602848 TGCAATCCTGAACAAGGCTGGGG No data
1057385512_1057385514 -3 Left 1057385512 9:94602774-94602796 CCATTTCTAGGAGGGCGTGAGTC No data
Right 1057385514 9:94602794-94602816 GTCGCCATGTTCAGGCTGCATGG No data
1057385512_1057385517 23 Left 1057385512 9:94602774-94602796 CCATTTCTAGGAGGGCGTGAGTC No data
Right 1057385517 9:94602820-94602842 CTCAGCTGCAATCCTGAACAAGG No data
1057385512_1057385518 27 Left 1057385512 9:94602774-94602796 CCATTTCTAGGAGGGCGTGAGTC No data
Right 1057385518 9:94602824-94602846 GCTGCAATCCTGAACAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057385512 Original CRISPR GACTCACGCCCTCCTAGAAA TGG (reversed) Intergenic
No off target data available for this crispr