ID: 1057387681

View in Genome Browser
Species Human (GRCh38)
Location 9:94618865-94618887
Sequence TGTCCACTTGCCTCTGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057387681_1057387684 30 Left 1057387681 9:94618865-94618887 CCATTGACAGAGGCAAGTGGACA 0: 1
1: 0
2: 2
3: 10
4: 158
Right 1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057387681 Original CRISPR TGTCCACTTGCCTCTGTCAA TGG (reversed) Intronic
900728100 1:4231765-4231787 TGCCCACTGGCCTCTCTCACTGG - Intergenic
901949091 1:12727190-12727212 TGTCCAGTTGCCACAGTGAAGGG + Exonic
902198193 1:14814030-14814052 CCTCACCTTGCCTCTGTCAATGG + Intronic
905657373 1:39693276-39693298 TGTCCACATACTTCTGTCCAAGG - Intronic
905766331 1:40604634-40604656 TGTCAACTTGACTGGGTCAAGGG + Intergenic
906153385 1:43600546-43600568 TGTCCCTGTGCTTCTGTCAAGGG + Intronic
912443228 1:109714278-109714300 TGGCCTCTGGCCTCTGTCATGGG + Intronic
912959357 1:114181445-114181467 TGTCTATGTGCCTCTGTCACAGG - Intergenic
915360756 1:155285129-155285151 TGTCCTCTTGCCCCTGGCAATGG + Intronic
915852336 1:159338727-159338749 TGTCCACTTCACTCTCTCTATGG + Intergenic
916586072 1:166151611-166151633 TGTCCACTTACATCTGGCCATGG - Intronic
917099347 1:171430014-171430036 GGTCGACTTGCCTTTGTAAAAGG + Intergenic
918693175 1:187508294-187508316 TGTCAACTTGCCTGTGTTAAGGG + Intergenic
920195583 1:204224097-204224119 TGTCAACTTGGCACAGTCAAGGG + Intronic
921328200 1:214008904-214008926 TGTCCACTTGTCCTTCTCAAAGG - Intronic
921819949 1:219605863-219605885 TGCCAACTTGCCTCTTTCTATGG + Intergenic
923950315 1:238944177-238944199 TGTCCCCTTCCCCCTGTCCAGGG + Intergenic
1063270177 10:4499801-4499823 TGTCCTCCTGCTGCTGTCAACGG - Intergenic
1063437912 10:6049475-6049497 TGTCCACTTGCCTGGGCTAAGGG - Intronic
1063979812 10:11444353-11444375 TGGGCACTTGCCTCTAACAAGGG + Intergenic
1064652457 10:17523329-17523351 TATCCACTTGCCTGGGTCACAGG + Intergenic
1065663510 10:28032827-28032849 TGTTCATTTGCCTCTCTTAAAGG - Intergenic
1070991036 10:80732434-80732456 TGTCCACTGTCCTCTCTGAAAGG + Intergenic
1071144217 10:82548660-82548682 TATCCACTTGCCTGTTTCACTGG - Intronic
1073065383 10:100755758-100755780 TGTCCATTTCCCTGTGACAAGGG - Intronic
1073357219 10:102866621-102866643 TGTGCACAGGCCTCTGTTAAAGG + Intronic
1073695347 10:105860452-105860474 TGTACCCTTGCCTCTGCCCAGGG + Intergenic
1074232951 10:111555741-111555763 TGTCCTCTTCCTTCTGTCATTGG - Intergenic
1074984503 10:118645127-118645149 TGTCCATTTGTTTGTGTCAATGG + Intergenic
1076399144 10:130168041-130168063 AGTGCACTTGCCGCTGTTAATGG + Intronic
1077585770 11:3451327-3451349 TGTCCATTTGCCTTAGTTAAAGG + Intergenic
1077873551 11:6283643-6283665 GGTTCACATGCCTCTGACAATGG - Intergenic
1078354475 11:10623910-10623932 TGTTCTCTTGGCTCTGTCTATGG + Intronic
1079385664 11:19977110-19977132 TTCCCACTGGCCTCTGTCAGCGG + Intronic
1081923731 11:46804652-46804674 TGTTTCCTTTCCTCTGTCAACGG - Intronic
1082957986 11:58892028-58892050 TGACCACTTGCCTGTGTAACTGG - Intronic
1084759978 11:71264422-71264444 TGTCCACTTGACTGGGTGAAGGG + Intergenic
1086833631 11:91596172-91596194 TGTCAACTTGACTGGGTCAAGGG - Intergenic
1086904642 11:92404646-92404668 TGTCCACTTGCTTGGGCCAAAGG + Intronic
1087006142 11:93473900-93473922 TCTCCACCTGATTCTGTCAAAGG - Intergenic
1087970034 11:104469261-104469283 TCTCCACTTGGCTCTGTCATGGG - Intergenic
1089417014 11:118300659-118300681 AGTCAACTAGCCTCTGTCCATGG + Intergenic
1090848558 11:130550437-130550459 TGTCCTATTGCCTCTGTACAGGG + Intergenic
1093773882 12:23049758-23049780 TGTCCACTTGACTGGGTTAAGGG + Intergenic
1095739126 12:45588021-45588043 TGTCAACTTGACTGGGTCAAGGG + Intergenic
1097601579 12:61699374-61699396 TGACCACTTGCTGCTGACAAGGG - Intergenic
1099754439 12:86825792-86825814 TGTTCACTTGCATCAGCCAAGGG - Intronic
1106422712 13:29596444-29596466 TGTGCATTTGCCACTGCCAAGGG - Intergenic
1107031401 13:35857730-35857752 TATCCACTGCCCTCTGTGAAGGG - Intronic
1108449902 13:50550792-50550814 TGTCCAGTTGCCTTTGTCAATGG + Intronic
1108882612 13:55139551-55139573 TGTGCAAATGCCTCTGACAAAGG - Intergenic
1112439958 13:99418059-99418081 GGTCCCATAGCCTCTGTCAATGG - Intergenic
1117971644 14:61256824-61256846 TATCTGCTTGCCTCTGTCAATGG + Intronic
1120831143 14:88998754-88998776 TGTCCAGTTGCTTTTGTCAATGG - Intergenic
1121630039 14:95415244-95415266 TGTCCACTTTCCTATGTCACAGG - Intronic
1122072316 14:99212739-99212761 TGTCCACTTGCCTGTGACCCAGG + Intronic
1122305693 14:100764957-100764979 TGTCAGCCTGCCTCTGTCATCGG - Intergenic
1122424519 14:101598162-101598184 TGTTCCCTCCCCTCTGTCAATGG - Intergenic
1123450538 15:20357020-20357042 TGTCCCCTGACCTCGGTCAATGG + Intergenic
1125363996 15:38894318-38894340 TGTACAGTTGCCTCAGTAAAAGG + Intergenic
1125542585 15:40478793-40478815 TGTCTACTTTCCTCTCTCATAGG + Intergenic
1127506511 15:59603203-59603225 GGTTCACATGCCTCTGACAATGG + Intronic
1129410471 15:75347988-75348010 TTGCCACTTGCCTCTGTCCCCGG - Intronic
1130015616 15:80183937-80183959 TGTCCTGTTGCCTCTTTAAATGG + Intronic
1131511454 15:93051517-93051539 TGTCCACTTGCGTGGGTCCATGG + Intronic
1132034356 15:98468851-98468873 AGTCCAATTGCCTGTGTCATTGG - Intronic
1132203077 15:99968454-99968476 TGTCAACTTGCCTGGGTAAAGGG + Intergenic
1132294570 15:100725933-100725955 TTTCCACCAGCTTCTGTCAAGGG + Intergenic
1133919944 16:10143227-10143249 TGTCCACTTTCTTCTTTGAAAGG - Intronic
1134000514 16:10779397-10779419 TGTCCACTCGTCTCTGCCATCGG + Intronic
1141362318 16:83407175-83407197 AGTCCACTTGCATCTGACATAGG - Intronic
1145003467 17:19321608-19321630 TTCCCACTTGCCTCTGTCAGGGG - Intronic
1145066563 17:19765676-19765698 TGTCCATTAGCCTCTGGCATAGG + Intergenic
1146452274 17:32984021-32984043 TGTCCACTTGACTGGGTCACAGG - Intronic
1147509166 17:41051772-41051794 TGAGCACTTACCTCTGTGAAGGG + Intergenic
1148634942 17:49141854-49141876 TGTCCCCTTGTCTCTGTGAGGGG + Intronic
1152609023 17:81306627-81306649 TGTCCACCTGCCTCCCTCTAGGG - Intergenic
1156396654 18:36705314-36705336 TGTGCACTTCCCTCTGCCCAGGG + Intronic
1157872753 18:51245745-51245767 TGTCCACTTGACTGAGTTAAGGG + Intergenic
1160863612 19:1248106-1248128 TGGCCTCCTGCATCTGTCAATGG - Intergenic
1162122332 19:8478933-8478955 GGTCTAGATGCCTCTGTCAAAGG - Intronic
1163183112 19:15617946-15617968 TGTCCACTTGACTGGGTTAAGGG - Intronic
1167739168 19:51313356-51313378 TTTCCACCTGCCTCTGTCTCTGG + Intronic
933214905 2:79618830-79618852 TTTCCAGTTGCCTCAGTCATGGG + Intronic
933273953 2:80264181-80264203 TGGCAACATGCATCTGTCAAGGG - Intronic
935554150 2:104489265-104489287 TTTCCCCTTCCCTCTGTAAAAGG + Intergenic
936638121 2:114282446-114282468 TGTCCACTGCCCACAGTCAAGGG + Intergenic
936936178 2:117840213-117840235 TGCCCACTTGTCTTGGTCAAGGG + Intergenic
938171383 2:129079763-129079785 TGTCAACTTGATTCTGTGAAGGG + Intergenic
939954053 2:148510418-148510440 TCTGCACTTGACTCTGTGAATGG + Intronic
944211214 2:197208435-197208457 TGCCCACTTACCTCTCTCACTGG - Intronic
947114232 2:226751635-226751657 TGTGCATCTGCCTCTGTCACTGG - Intronic
947233177 2:227909915-227909937 TGTCAACTTGACTGTGTTAAGGG - Intronic
1175201798 20:57283264-57283286 TCCCCACTTGGCTCTTTCAAGGG - Intergenic
1175864489 20:62167724-62167746 TGTCCACATGCGTCTGCCCAAGG + Intronic
1178207281 21:30484836-30484858 TGTCAATTTGACTCTGTTAAGGG + Intronic
1179165744 21:38933855-38933877 TCTCCACTTCCCTCTGTTCACGG + Intergenic
1181172088 22:21015534-21015556 TGTCCACTTGCCTCCTTCCCAGG + Intronic
1182375437 22:29843826-29843848 TGTCCCCTGGCATCTCTCAAAGG + Intergenic
1182538491 22:31024107-31024129 GGTCCAAATGCCTCTGACAATGG + Intergenic
1183583512 22:38739189-38739211 TTGCCACTTGCCTTTGTCATGGG + Intronic
1183941385 22:41297449-41297471 TGTCCACTTGCCTGGGCCACAGG - Intergenic
1184977844 22:48075789-48075811 TGTCCACTTGCCTGGGCCATAGG + Intergenic
953718581 3:45336226-45336248 TGTCCACGTCCCTCTGGCACAGG + Intergenic
955416494 3:58696725-58696747 GGTTCACATGCCTCTGACAAAGG - Intergenic
961321709 3:126081746-126081768 TGCCCAGTTGCCTCTGGCAGAGG - Intronic
964497386 3:157306543-157306565 TTTCCACATTCCTCTATCAAGGG + Intronic
964695575 3:159504110-159504132 TGTCCTCTCTCCTCTGTTAATGG - Intronic
965032878 3:163396216-163396238 TTTCCACTTGCCTCTGTCCTTGG + Intergenic
970212796 4:13728710-13728732 TGTACATTTGCTTATGTCAAAGG - Intergenic
971585593 4:28402372-28402394 GGTTCCCTTGTCTCTGTCAAAGG + Intronic
973105871 4:46336304-46336326 TCTCAACCTGCCTTTGTCAATGG - Intronic
974030780 4:56774346-56774368 TGTCCACTTGCTTCCTTTAATGG - Intergenic
977483285 4:97607766-97607788 TGTCCACTTGCCACTCTAGATGG - Intronic
977989665 4:103425585-103425607 TTTCCACCTGCCTCTGCTAAGGG - Intergenic
978100869 4:104840060-104840082 TATCCACTTGGCTGTCTCAAAGG - Intergenic
979561062 4:122102733-122102755 TGGACACTTGCCTCTGCCATAGG - Intergenic
983851653 4:172588170-172588192 TGTCCACTTCCCCCTGAAAAAGG + Intronic
986010626 5:3711605-3711627 TGTCCACTTGGCTGGGTTAAGGG + Intergenic
986062746 5:4207334-4207356 TGACGTTTTGCCTCTGTCAATGG - Intergenic
989468293 5:41783976-41783998 TATCCTTTTGCTTCTGTCAAAGG + Intronic
993469424 5:88288707-88288729 TGTCAACTTGGCTGTGTTAAGGG - Intergenic
994867348 5:105293005-105293027 TGTCCATTTTGCTCTGTAAATGG - Intergenic
1000904809 5:166952347-166952369 TCTTCACTTGGCTCTGTCAGTGG - Intergenic
1000951640 5:167491063-167491085 TGGACACTTGCCTCTGGAAAAGG - Intronic
1006564410 6:34942720-34942742 TGTACACTTTCTTCTGTCATTGG + Intronic
1007134457 6:39507824-39507846 TGACCACTTGATTCTGTCACAGG + Intronic
1007640303 6:43333150-43333172 TGTCCTCTTGCTTCTGTCCTGGG - Intronic
1008339046 6:50342613-50342635 TGTCCACTTGCCTCATTCTGGGG + Intergenic
1009565691 6:65308724-65308746 TGCCAACTTGCCTCTTTCTATGG - Intronic
1011738904 6:90339817-90339839 TGTCAACTTGCCTGTGCTAAGGG + Intergenic
1017122232 6:151035144-151035166 TGCCTACTTGCCTTTGTCAGTGG - Intronic
1017982866 6:159417487-159417509 TGTCCACTGGCCTCTGCCCCTGG - Intergenic
1021080615 7:16359716-16359738 GGTCCTCTTGGCACTGTCAAAGG - Intronic
1021307111 7:19045684-19045706 TCTCCTGTTGCCTCTGTCAATGG - Intronic
1023814501 7:43939224-43939246 TGGCCACTTGCCTCTGCCAAGGG + Intronic
1026306720 7:69148823-69148845 TTTGCAATTGCCTCTGTCAGAGG - Intergenic
1030055478 7:105580675-105580697 TGTCCATTTGCTTCTGTGTAAGG - Intronic
1030249904 7:107430961-107430983 TGTCCACTTCCCTTGGTTAATGG - Intronic
1032868172 7:135950598-135950620 TGTGAAATTGCTTCTGTCAAAGG - Exonic
1034401289 7:150863331-150863353 TGTCTGCTTTCCTCTGTCAGTGG - Intergenic
1035934898 8:3826002-3826024 TATTCACTTGCCTTTTTCAAAGG + Intronic
1037317347 8:17611457-17611479 TGTCCAGTGGCCTTTGTAAAAGG - Intronic
1038022279 8:23560658-23560680 GGGCCACTTGCCTCTGTCTGGGG + Intronic
1038134083 8:24767066-24767088 TGTTCACCTGCCCCTGTGAAGGG + Intergenic
1041799531 8:61784208-61784230 TGTCCACTTGACTGGGTTAAAGG - Intergenic
1043716270 8:83490637-83490659 TGACAACTTGCCTTTGTTAAGGG + Intergenic
1046085343 8:109427416-109427438 GCTCCACCTGCCCCTGTCAAGGG - Intronic
1048173533 8:132130669-132130691 AGTCCACATGCTTCTGTCTAAGG - Intronic
1049951703 9:650939-650961 TTTCCTCCTGCTTCTGTCAAAGG + Intronic
1049981247 9:905649-905671 GGTCCACCTGCTTCTGTCAACGG - Intronic
1055768649 9:79692371-79692393 TGTCCATTACCCTCTTTCAAAGG + Intronic
1056601097 9:88047633-88047655 GATCCACCTGTCTCTGTCAAAGG - Intergenic
1057387681 9:94618865-94618887 TGTCCACTTGCCTCTGTCAATGG - Intronic
1057585595 9:96325724-96325746 AGTTCACTTCTCTCTGTCAATGG - Intronic
1058595986 9:106616233-106616255 ATTCCACTTGGCTCTGTCTACGG + Intergenic
1058609562 9:106760681-106760703 TGTCTACTTCCCTTAGTCAAGGG + Intergenic
1058969010 9:110063273-110063295 GGTCTTCTAGCCTCTGTCAATGG - Intronic
1186932649 X:14411844-14411866 TGTTCAATTGCTTCTGTCATGGG - Intergenic
1187486311 X:19707564-19707586 TGTCCTCTTCCCTCTGTCCCAGG + Intronic
1187525718 X:20052867-20052889 TGTTCACTTGCCTCGGTCTGGGG + Exonic
1187831686 X:23388881-23388903 TCTCCACTTTCCTCTTTCAGTGG - Intronic
1187961996 X:24575285-24575307 TGTCCACTTGGTTCTGGAAACGG + Exonic
1188833039 X:34924321-34924343 TGTCCTCTTGTCTTTGACAAGGG - Intergenic
1193235363 X:79100283-79100305 TGTCCACTTGACTGGGCCAAGGG + Intergenic
1193534606 X:82697994-82698016 TGCTCTCTTGCCTCTGTAAATGG + Intergenic
1194985115 X:100481731-100481753 TGTCAACTTGACTATGTTAAGGG - Intergenic
1200065270 X:153501781-153501803 TGTCCTTCTGCCTCTGTCACGGG + Intronic
1200949275 Y:8878431-8878453 AGGCCAATTGCCTGTGTCAACGG - Intergenic
1201642758 Y:16197474-16197496 TGTCCACTTCTCTCAGCCAAGGG - Intergenic
1201660057 Y:16387847-16387869 TGTCCACTTCTCTCAGCCAAGGG + Intergenic