ID: 1057387684

View in Genome Browser
Species Human (GRCh38)
Location 9:94618918-94618940
Sequence CCAGTTTACCAGCACATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057387681_1057387684 30 Left 1057387681 9:94618865-94618887 CCATTGACAGAGGCAAGTGGACA 0: 1
1: 0
2: 2
3: 10
4: 158
Right 1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057387684 Original CRISPR CCAGTTTACCAGCACATCAC TGG Intronic
No off target data available for this crispr