ID: 1057388210

View in Genome Browser
Species Human (GRCh38)
Location 9:94622669-94622691
Sequence AAAGAGAAGCAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1992
Summary {0: 1, 1: 1, 2: 24, 3: 235, 4: 1731}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057388210 Original CRISPR AAAGAGAAGCAGCAGGAGGA GGG (reversed) Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901215934 1:7555446-7555468 AAAGAGGAGAAGGAGGAGCAGGG - Intronic
901400547 1:9012424-9012446 ACAGAAATCCAGCAGGAGGAAGG + Intronic
901405342 1:9041341-9041363 AAAGAGAAGTACCAGGAGTGAGG - Intronic
901574679 1:10191358-10191380 ACAGAGAAACAGCAGGAGCAAGG + Intergenic
901631374 1:10649790-10649812 AAAGAAGCGCAGAAGGAGGAGGG + Intronic
902209156 1:14892406-14892428 AAAGAGAGACAGCAGGGGGGAGG - Intronic
902361596 1:15945133-15945155 CAAGAGGAGCAAGAGGAGGAGGG - Exonic
902614909 1:17618489-17618511 ACAGAGGAGGAGGAGGAGGAGGG - Intronic
902726686 1:18340884-18340906 AAGGAGAAGAAGCAGAAGCAGGG - Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902818834 1:18931250-18931272 AGACAGAAGCAGTGGGAGGAGGG - Intronic
903021645 1:20399367-20399389 AAAGACAAGTAGTAGGAGAAAGG - Intergenic
903187450 1:21636849-21636871 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
903270874 1:22187492-22187514 GAAGAGAAGGGGCTGGAGGAAGG - Intergenic
903361747 1:22781332-22781354 AAAAAGAAGAAGAAGGATGAGGG + Intronic
903646662 1:24900239-24900261 CAAGAGAAACCGCAGCAGGAGGG + Exonic
904120322 1:28193924-28193946 AATGAGCAGCAGCAGGATGAAGG + Intronic
904130027 1:28268672-28268694 AAAAAGAAGCAAAAGAAGGAAGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904585289 1:31576634-31576656 ACAGAGAAGAAACAGGGGGAGGG + Intronic
904745859 1:32710450-32710472 AGAGAGAGGAAGCAGGAGAAAGG - Intergenic
904991773 1:34598931-34598953 ACAGAGGAACAGCAAGAGGAGGG - Intergenic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905280515 1:36846220-36846242 AAACAGCAGCAGCAGGAGACTGG - Intronic
905319102 1:37103126-37103148 AAAGACAAGAAGGAGGAAGAGGG + Intergenic
905535973 1:38722135-38722157 AAAGAGAAGAAGGGAGAGGAAGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
905942920 1:41878686-41878708 AAAGAGAGGGAGGAGGAGGGAGG - Intronic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192104 1:43905241-43905263 GAAGAGGAACAGGAGGAGGAGGG - Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906321743 1:44821543-44821565 AAAGCCATGCAGCAGGTGGAAGG - Intronic
906534375 1:46543640-46543662 ATAGAGAGGGAGCAGGAGAAGGG - Intergenic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906646480 1:47478844-47478866 AGAGAGGAGGAGCAAGAGGAGGG - Intergenic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
906816490 1:48885627-48885649 CAAGAGAAACAGCAGAAGAAAGG - Intronic
906969048 1:50491074-50491096 ACAGAGAAAGAGCAGTAGGAGGG - Intronic
907321692 1:53606643-53606665 AAAGAGGAGCAGCAGGAAGGTGG + Intronic
907584449 1:55604527-55604549 AAAGAGAAAAAGCAGAAGCAAGG - Intergenic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907843816 1:58185235-58185257 AGAGGGAAGCAGGAGAAGGATGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907920756 1:58909495-58909517 AAAGGGAAGAAGAAGGATGATGG + Intergenic
908001982 1:59689269-59689291 GCAGAGAAGCAGCAGGAAGAGGG + Intronic
908031836 1:60008865-60008887 AATGCCAAGCAGCTGGAGGAAGG - Intronic
908248419 1:62246061-62246083 AAAGTGGGGCAGCAGGAAGACGG + Intronic
908411243 1:63867844-63867866 AAAGAGAAGCAGATCAAGGAAGG - Intronic
908516438 1:64897445-64897467 GAAGAGGAGCAGGAGGACGAGGG + Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908554558 1:65244884-65244906 ATATAGAAGGAGCAGAAGGAGGG + Intergenic
908702767 1:66920145-66920167 AAAGAGAAGCAGCTGGACGTTGG + Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908838473 1:68253350-68253372 AAAGAGAAGAATCATGAGGTGGG + Intergenic
908950416 1:69555243-69555265 AATGAGAAGGAGCTGGACGATGG + Intergenic
909172120 1:72310452-72310474 AAGGAGAAGGAGCAGAATGAGGG - Intergenic
909539269 1:76772474-76772496 ATAGAGAAGTAGCTGGAGAAGGG - Intergenic
910217057 1:84853514-84853536 AGAGAGAAGAAGCAGGAAGAGGG - Intronic
910837069 1:91525205-91525227 AAAGGGAAGCTGCAGGACCAAGG + Exonic
910985907 1:93004284-93004306 AAAGAGAAATAGGAGGAAGATGG - Intergenic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911122740 1:94312327-94312349 AAAATGAAGAAGAAGGAGGAAGG - Intergenic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911791799 1:102026539-102026561 AAAAAGAAGCAGCACCAGGATGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911830222 1:102541279-102541301 ACAGGGCAGGAGCAGGAGGAAGG + Intergenic
912046075 1:105459583-105459605 AAAGAGACCTTGCAGGAGGAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912420049 1:109536516-109536538 AAAGAGAAGAAGCAGAACGTTGG - Intergenic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
912536822 1:110380066-110380088 AAAAAAAAGCAGCGGGAGGGAGG + Intronic
912658615 1:111509107-111509129 AAACAAAAGCAGCACCAGGATGG + Intronic
912662372 1:111543720-111543742 AAAGAGGAGGAGGAAGAGGAGGG + Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913269055 1:117075158-117075180 CAAGAGAAGAAGCAAGAAGAGGG + Exonic
913296378 1:117324682-117324704 GAAGAGAAGGAGCAAGAGGAGGG - Intergenic
913433512 1:118822249-118822271 AAAAACAAGCGGCAGGGGGAGGG + Intergenic
913495286 1:119422716-119422738 AAAGAGAGGCAGCAGGACCTGGG - Exonic
913596567 1:120384610-120384632 ATAGCCAAGCAGCAGGAGTAGGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914090703 1:144494372-144494394 ATAGCCAAGCAGCAGGAGTAGGG + Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914307904 1:146439843-146439865 ATAGCCAAGCAGCAGGAGTAGGG - Intergenic
914357827 1:146902967-146902989 ATAGAGGAAAAGCAGGAGGAAGG - Intergenic
914440569 1:147702197-147702219 AAAGAGAAGCTGGATGATGATGG + Intergenic
914474716 1:148013706-148013728 CAAGAGAAGCAGCAAGGGAAGGG + Intergenic
914594205 1:149133290-149133312 ATAGCCAAGCAGCAGGAGTAGGG + Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
915008131 1:152659562-152659584 AAAGAGCAACACCAGGAGTATGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915449722 1:155996216-155996238 AAAAAGAAGCAACACGATGATGG - Intronic
915571787 1:156748877-156748899 AAAGAGAAGGTACAGGGGGAAGG + Intronic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915917269 1:159948080-159948102 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
915963903 1:160290058-160290080 GAAGAGTAGCTGCAGGGGGAAGG + Exonic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916398762 1:164422430-164422452 AAAGAGAAACAGCAAGAGAGAGG - Intergenic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916657077 1:166885796-166885818 CAAGAGGAGAAGGAGGAGGAGGG - Intergenic
916664166 1:166950399-166950421 AAAGAGAAGGAGAAGGAGAGAGG + Intronic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
916678007 1:167080465-167080487 AGAGAGAAGCACTAGGAGGCAGG - Intronic
916885343 1:169061890-169061912 GAAGAGGAGGGGCAGGAGGAGGG + Intergenic
917143521 1:171862806-171862828 AAAGAGAAGCAGCAACAGAAGGG + Intronic
917166144 1:172115370-172115392 AAAGAGGAGAAGCAGGAGGGAGG - Intronic
917524216 1:175773035-175773057 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
917554081 1:176066160-176066182 AAAGAGAAGTAACAAGAGAAAGG - Intronic
917906236 1:179589138-179589160 CCAGAAAAGCAGCAGCAGGAGGG + Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918147440 1:181769945-181769967 AAAGAGAAGAAGCAGCTAGAGGG - Intronic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918269494 1:182883563-182883585 AAAGAGAAGCAACTGCAGGGGGG - Exonic
918621907 1:186614909-186614931 AAAAAGAAACAGGAGGTGGAAGG + Intergenic
918876362 1:190049597-190049619 AAAGATAGGGAGCAGGATGAAGG + Intergenic
918928942 1:190827775-190827797 GAAGAGTAGTAGGAGGAGGAGGG - Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919176734 1:194028458-194028480 AAAAAGGAGGAGGAGGAGGAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919757849 1:201077046-201077068 GAAGAGCAGCAGCAGCAGGGAGG + Exonic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919876742 1:201874867-201874889 GAAGAGGAGGAGGAGGAGGATGG + Exonic
919988839 1:202694787-202694809 GGAGAGAAGGAGGAGGAGGAGGG - Intronic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920704112 1:208239498-208239520 AAAGAAAACCAGCAGGTGGATGG - Intronic
921119294 1:212123051-212123073 GAAAAGAAGCAGCAAGACGATGG - Intergenic
921249374 1:213281960-213281982 AAAGAGACGGAGCAAGGGGAGGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
922098638 1:222463921-222463943 AAAGAGCAGAATAAGGAGGATGG + Intergenic
922137882 1:222850403-222850425 AAAGTGTAGCAGTTGGAGGATGG - Intergenic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922779225 1:228238117-228238139 AAAGGAGAGCAGCAGGTGGATGG - Intronic
922793112 1:228321509-228321531 AAGGAGATGAAGCAGCAGGAAGG + Exonic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922975064 1:229777631-229777653 AAGGGGAAGCAACAGGAAGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923135998 1:231119759-231119781 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923272326 1:232368920-232368942 AAAGAGGAGGAGCAAGAGGAAGG - Intergenic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923650959 1:235873040-235873062 AAAGAGAAGCAGGAGAAAGGAGG + Intronic
923827397 1:237515700-237515722 GAAGAGAAGAAGGAGAAGGAGGG - Intronic
924486430 1:244487779-244487801 GCAGAGAGGCAGCAGGAGGCGGG + Intronic
924557454 1:245130071-245130093 AAAGAGAAGCAGAAAGAAAATGG + Intergenic
924600665 1:245485972-245485994 TAAGAATAGCAGCTGGAGGACGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063224215 10:4000088-4000110 AAAGAGTATCAGCAGGGGCAGGG - Intergenic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063916085 10:10884003-10884025 AAAGAGGAAGAGCAGGAGGGAGG - Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1063997051 10:11629278-11629300 AAAGAGATGGAGGAAGAGGAAGG - Intergenic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1064913858 10:20434792-20434814 CAAGAGAGGCAGCAAGAGGCAGG - Intergenic
1064971040 10:21067462-21067484 AAAAAGAGAAAGCAGGAGGAGGG + Intronic
1065050534 10:21787337-21787359 AAAAAGGAGGAGGAGGAGGAAGG + Intronic
1065819548 10:29512800-29512822 AAACAGACTCAGCAGGAGGCAGG - Exonic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1065953307 10:30671605-30671627 AAACAGACTCAGCAGGAGGCAGG + Intergenic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066063518 10:31745181-31745203 GAAGAGAAGGAGCAAGGGGAGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067343132 10:45419928-45419950 AAAGAGAGGCCGGAAGAGGAGGG + Intronic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1068016643 10:51525164-51525186 GAAGAGAAGGAAGAGGAGGAGGG + Intronic
1068174778 10:53444329-53444351 AAAGAGATGGAGCAAGATGAGGG + Intergenic
1068395726 10:56458727-56458749 AAAAAGAAGAAGTAGGAGGAGGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069211624 10:65768636-65768658 AGAGAGAAGTAGCAGCAGGCAGG - Intergenic
1069267072 10:66473353-66473375 AGAGAGAAGCATGAGGAGCAAGG - Intronic
1069432285 10:68348529-68348551 AAAAAAAGGCAGCAGCAGGAAGG + Intronic
1069567817 10:69475118-69475140 AAAGAAAACCAGGGGGAGGAGGG + Intronic
1069612112 10:69780961-69780983 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1069766850 10:70868512-70868534 GAAGAGAAGCAGCAGGAAAATGG - Intronic
1069917276 10:71795492-71795514 GAAGAGAGTCAGCTGGAGGAAGG - Intronic
1070175427 10:73965710-73965732 AAGGAGAAGAAGCACAAGGACGG + Intergenic
1070522078 10:77262692-77262714 CAAGAGAGGGAGCAGGAGCAAGG - Intronic
1070674948 10:78406071-78406093 AAAGAGAAGGATTAGGAGCATGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071252967 10:83839682-83839704 TAAGAGAAGCAGCAACAGAAAGG + Intergenic
1071347920 10:84710972-84710994 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072066038 10:91872667-91872689 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1072084198 10:92062388-92062410 AAAGAGAAGTAGCTGCATGAAGG + Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072193698 10:93096991-93097013 GAAGAGAACCAGCAGGAGCCGGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072251090 10:93582890-93582912 GAAGAGAGTGAGCAGGAGGAGGG + Intronic
1072279207 10:93850779-93850801 GAAGAGAAGCAGCAGGACGTCGG + Intergenic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072865611 10:99057833-99057855 AAAGAAAAGAAACAGGAAGAGGG - Intronic
1072940127 10:99755555-99755577 AAAATGAAGCGGCAGTAGGAGGG + Intronic
1073043680 10:100623832-100623854 AGAGAGAAGAGGCAGGAGGAAGG + Intergenic
1073081189 10:100861973-100861995 AAAGAGGAGAAGCAGTAGGAAGG - Intergenic
1073275930 10:102311377-102311399 AAAGAGAAGCTGCAGGGGATGGG + Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073439340 10:103543499-103543521 AAAGAGGAAGAGGAGGAGGAGGG - Intronic
1073510415 10:104039313-104039335 AGAGAGAAGAGGCTGGAGGAAGG - Intronic
1073875208 10:107914704-107914726 AGAGAGGAGCAGCAGGAGCCCGG + Intergenic
1074043986 10:109819985-109820007 GGAGAGAAGCTGCAGGAGGGTGG - Intergenic
1074714265 10:116203551-116203573 AGAGAGAGGCAGCTGGGGGAAGG + Intronic
1074720874 10:116264105-116264127 CAAGAGAGGCTGCAGTAGGAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1074951622 10:118342391-118342413 AAAGGGAAGCCCCAGGAGGCCGG - Intergenic
1075049901 10:119175734-119175756 AAAGAGGAGCAGGAGGAAGGGGG + Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075271384 10:121054644-121054666 GGAGAGATGCTGCAGGAGGAGGG - Intergenic
1075452517 10:122561827-122561849 ACAGAGAAGGAGGAGGAGGGAGG - Intronic
1075540395 10:123307807-123307829 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075618383 10:123907914-123907936 AGAGAGGGGAAGCAGGAGGAAGG + Intronic
1075974951 10:126686838-126686860 ATAGAGAAGGAGCAGGAGAGGGG - Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076406115 10:130213550-130213572 ACATAGCAGGAGCAGGAGGAGGG - Intergenic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076944607 10:133637651-133637673 ACAGGGAAGCGGCTGGAGGAAGG - Intergenic
1077073226 11:687333-687355 AGCGAGAAGAAGCAGGAGGGAGG - Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077460065 11:2704621-2704643 GAAGAGAGGCAGCAGGGTGAGGG + Intronic
1077523596 11:3050695-3050717 AAAAAAGAGCAGCAGGTGGAGGG - Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077663741 11:4091047-4091069 TAAGAGAGGAGGCAGGAGGAGGG - Intronic
1077693432 11:4370466-4370488 AGAGAAAAGGAGCAGGAGGAAGG - Intergenic
1077998904 11:7477024-7477046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1078008070 11:7547529-7547551 AAAGGGGGGAAGCAGGAGGAAGG - Intronic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078619274 11:12892666-12892688 AAAAAGAAGCAGCAGCAGTAAGG + Intronic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079386858 11:19988164-19988186 AAAGAAAAGGATGAGGAGGATGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079735442 11:23992114-23992136 AAACAGTAGCAGCCGGAGGGAGG - Intergenic
1079810950 11:24999372-24999394 AAGGAGGAGGAGCAGGAAGATGG + Intronic
1080293851 11:30702630-30702652 GAAGTGGAGCAGCAGCAGGATGG + Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1080612925 11:33920619-33920641 GAAGAGGAGCAGCATGAGGTTGG + Intergenic
1081305747 11:41509865-41509887 TAAGAGGAGAAGGAGGAGGAAGG + Intergenic
1081494815 11:43597929-43597951 AAAGAAAAGCAGGAGGGGGCTGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081578538 11:44334879-44334901 AGAGAGAAGCTTCAAGAGGACGG - Intergenic
1081613103 11:44575196-44575218 AAAGAGAAGGAGATGGAGAAAGG + Intronic
1081646766 11:44795635-44795657 AATCAGAAGCGGCAGGAGTAAGG - Intronic
1082631135 11:55543775-55543797 AAATAAAAGCAGGAGGAGTAGGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1082771053 11:57207596-57207618 GTAGAGAAGTAGCAGGAGGAAGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083077506 11:60056294-60056316 TAAGAGAAGCATCTGGAGGAGGG - Intergenic
1083143156 11:60738197-60738219 AAAGGGAAGCAGCTTGAGTAGGG + Intronic
1083169291 11:60913371-60913393 GAGGAGAAGCAGCTGGATGAGGG - Intergenic
1083626730 11:64075664-64075686 AAAAAGAAGCAGCAGCAGCCAGG - Intronic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1083732857 11:64662303-64662325 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084203201 11:67576085-67576107 AAAGAGGAACATCAGGAAGATGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084754990 11:71232518-71232540 AAAGAGGAGGAGGAGGAGAAGGG - Intronic
1084775827 11:71374408-71374430 ATAGGGAAGCTGCTGGAGGAAGG + Intergenic
1085244484 11:75089048-75089070 GGAGAGAAGCACCAGGAGAAGGG + Exonic
1085249240 11:75131315-75131337 GGAGAGAAGCACCAGGAGAAGGG + Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085867516 11:80312053-80312075 AATGAGCAGAAGCAAGAGGATGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086259613 11:84923429-84923451 AAAAAGAAGAAGAAGAAGGAGGG + Intronic
1086308110 11:85503935-85503957 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1086518274 11:87640022-87640044 AAAGAGAAAAAGGAGGAGAAAGG - Intergenic
1086575759 11:88337622-88337644 GGAGAGAAGCAGCAGGAGGGCGG + Exonic
1086827631 11:91519050-91519072 AAAGAGGAGAAGGAGGAGGGAGG + Intergenic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087026992 11:93659917-93659939 AAAGGGATGGAGTAGGAGGAAGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088079549 11:105894641-105894663 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1088248328 11:107840692-107840714 CCAGAGAAGCAGCAGGAGCCAGG - Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088446112 11:109930384-109930406 AAATAGAAGCAGCAGGAAGGTGG - Intergenic
1088494376 11:110418787-110418809 CCAGAGAATCAGCAGGAGGTAGG - Intergenic
1088623580 11:111711651-111711673 AAAGAGAAGCAGCAGTCACATGG - Intronic
1088626355 11:111733180-111733202 AAAGGGAGGCAGCAGCAGGAAGG - Intronic
1088711646 11:112513816-112513838 AAAGAGAAGCAGGAGGCATAGGG + Intergenic
1088886489 11:114011570-114011592 AAAGAGTAGAAGCAGGGAGAAGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089310629 11:117555965-117555987 GAAGAGAAGGTGGAGGAGGAGGG + Intronic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1089712589 11:120326175-120326197 AAAGAAAAGAAGGAAGAGGAAGG - Intronic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090028187 11:123185397-123185419 AGAGAGAGAGAGCAGGAGGAAGG + Intronic
1090418838 11:126559428-126559450 GTAGAGAATCAGCTGGAGGAGGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1090968924 11:131622973-131622995 AAAGAGAAAGAGGAAGAGGAAGG + Intronic
1090972153 11:131653267-131653289 TAAGAGAGACAGCAGGTGGAGGG - Intronic
1091305886 11:134535833-134535855 TAAGAGCAGCAGGAGGAGCACGG - Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091541683 12:1468256-1468278 ACAGAAAAGCTGCAGGGGGAAGG + Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1091736382 12:2925423-2925445 CAAGAGAGGTACCAGGAGGAAGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1092756229 12:11766053-11766075 AGAATGAAGAAGCAGGAGGAAGG + Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093091272 12:14923543-14923565 AAAGAGAACCAACAGGAGATAGG - Intronic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093706277 12:22277881-22277903 GAAGAAAAGAAGCAGGAGAAAGG + Intronic
1093775328 12:23067138-23067160 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1093870185 12:24281742-24281764 AAAGTGAAGCATGAGGGGGATGG + Intergenic
1093912323 12:24762143-24762165 GTAGAGAAGCAGCACTAGGATGG - Intergenic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094129852 12:27063204-27063226 AAAGAGGAGGAGGAGGAGAAGGG - Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1095311015 12:40696656-40696678 GAAATGTAGCAGCAGGAGGATGG + Intronic
1095528611 12:43158024-43158046 TGAGAAAAGCAGCAAGAGGATGG + Intergenic
1095624695 12:44301174-44301196 ACAGAGTAGAAGCATGAGGATGG - Intronic
1095651776 12:44619647-44619669 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1095918991 12:47510104-47510126 AGATAGAAACAGCAGAAGGAAGG - Intergenic
1095948430 12:47767063-47767085 AAGGCGAAGCTGCAGGAGGGGGG + Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096065315 12:48735024-48735046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096500083 12:52059321-52059343 AGAGAGAGCCAGCAGGAGGCTGG - Exonic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1096803667 12:54127482-54127504 CAAGAGATGCCCCAGGAGGAAGG + Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097258094 12:57695904-57695926 TAAGAGGAGGAGGAGGAGGAGGG - Intronic
1097383872 12:58926064-58926086 AAAGAGAAGAAGAAGAAGCAAGG - Intergenic
1097548070 12:61029857-61029879 AAAGAGGAGGAGGAAGAGGAAGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098190110 12:67938945-67938967 AAATAGAAGGAGCCAGAGGAAGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098708005 12:73715872-73715894 AAAGAGAAGGAGAAGGAGAGAGG + Intergenic
1098844997 12:75523884-75523906 AAACAGATGGAGCTGGAGGATGG + Intergenic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099279629 12:80627391-80627413 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1099316374 12:81087405-81087427 GAAGAGCAGGAGGAGGAGGAAGG + Intronic
1099398440 12:82170985-82171007 AAAAAGAAGGAGGAGGAGGGAGG + Intergenic
1099402811 12:82221035-82221057 AAAGAAAAAAGGCAGGAGGAAGG - Intergenic
1099437089 12:82658121-82658143 AAATGGAGGCTGCAGGAGGAAGG + Intergenic
1099758869 12:86892934-86892956 AACTAGAAGCAGCAGGGGCAGGG - Intergenic
1100037506 12:90270901-90270923 AAAAAGCAGCAGGAGAAGGAAGG - Intergenic
1100201240 12:92299896-92299918 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1100201249 12:92299923-92299945 GAAGAGGAGAAGGAGGAGGAGGG + Intergenic
1100257545 12:92899751-92899773 AATGAGAACGAGCAAGAGGAAGG - Intronic
1100260166 12:92925761-92925783 AAAAAGGAGGAGCAGGAGGAGGG + Intronic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100546061 12:95603721-95603743 AAAGGGAAGAAGTAGGAAGAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101136536 12:101749751-101749773 AAAGAGAAGGAGCAGTAGAGTGG + Intronic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101193770 12:102361759-102361781 GAAGAGGAGGAGGAGGAGGACGG + Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101486992 12:105174851-105174873 AAAAAAAAGCAGCAGCAGCATGG - Intronic
1101883938 12:108645359-108645381 AAAGAGAAGCAGGAGGGCAAGGG - Exonic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1102230337 12:111257516-111257538 AAAGAGGAGGAGAAGGAGGGAGG - Intronic
1102398456 12:112608096-112608118 AAAAAGAAAGAGGAGGAGGAGGG - Intronic
1102446163 12:113004373-113004395 AAAGAGGAGGAAGAGGAGGAGGG + Intronic
1102491525 12:113292256-113292278 AAGGAGAAGCCTCTGGAGGACGG - Intronic
1102516399 12:113449770-113449792 CAAGACTAGCAGCAGGAGGCTGG - Intergenic
1102734916 12:115151005-115151027 GAAGAGATGGGGCAGGAGGAGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103059496 12:117847410-117847432 CAAGAGAAGAAGCCAGAGGAGGG + Intronic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103375596 12:120453146-120453168 AAAGAAAAGCAGTGGGAGAACGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1103932383 12:124457588-124457610 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1104054727 12:125220725-125220747 AAACAGACACAGCAGGACGAGGG - Intronic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104569351 12:129911358-129911380 AAATAAACGCAGCAGCAGGAGGG + Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1106216577 13:27707215-27707237 AAAGAGAGAGAGCAAGAGGAGGG + Intergenic
1106243033 13:27925277-27925299 AAAGAAGAGGAGGAGGAGGAAGG - Exonic
1106243111 13:27925574-27925596 AAAGAGGAGGAGGAAGAGGAGGG - Exonic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106763979 13:32895412-32895434 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107031494 13:35858450-35858472 AAAGACAAACAGCTGGAAGATGG + Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107305892 13:39018738-39018760 AAATAAGAGTAGCAGGAGGAGGG + Intronic
1107457508 13:40568373-40568395 AAAGAGAGGAAGGAGGAGGGAGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108038786 13:46320400-46320422 AAAAAGAAAAAGGAGGAGGAAGG + Intergenic
1108151028 13:47534602-47534624 AAAAAGAAGCAGCAGCAGCAGGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108440415 13:50447493-50447515 AGAGAGAAGCAGCTGGACAATGG - Intronic
1108475019 13:50807402-50807424 TGAGAGAAGCAGGAGGAGGGAGG - Intronic
1108639705 13:52371706-52371728 TAACAGCAGCAGCAGCAGGATGG + Intergenic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109053499 13:57515057-57515079 AAAGAGAAGTTGCAGTAGGGAGG + Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109142321 13:58729753-58729775 AAATAGAAGTAGCAATAGGATGG + Intergenic
1109817983 13:67612630-67612652 AAATAGAAGCAACTGGAGTATGG - Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110146126 13:72192458-72192480 AAAGAGAAAAATCAGGAGGAAGG - Intergenic
1110416442 13:75258775-75258797 ACCTAGAAGCACCAGGAGGAGGG - Intergenic
1110519229 13:76455827-76455849 GAAGAGAAGCAGGAGAGGGAGGG + Intergenic
1110854263 13:80279067-80279089 ACAGTGAAGCAGCAGGCTGAAGG + Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1111656063 13:91155219-91155241 CAACAGAAGCAGCAGCAAGAAGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112384248 13:98923271-98923293 AAAGAGAAGCAACAGCAAGCAGG + Intronic
1112490511 13:99859090-99859112 AAGGAGGAGTAGCAGGAAGAAGG + Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1112672191 13:101653177-101653199 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113200839 13:107866695-107866717 AGAGAGAAGAAACGGGAGGAGGG - Exonic
1113221425 13:108107978-108108000 AAAGAAAGGAAGGAGGAGGAGGG + Intergenic
1113556594 13:111240534-111240556 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113897327 13:113774118-113774140 GAAGAGAAGAAGCAGGCGGGGGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114400279 14:22403704-22403726 AAAGAGAGCCAACAGGATGAAGG - Intergenic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114866175 14:26597869-26597891 AGAGTGAATGAGCAGGAGGAGGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115175604 14:30558768-30558790 AAACAGCAGCAGCAGCAAGAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115314849 14:32014854-32014876 ACAGGGAAGCTGCAGGAAGAAGG - Intronic
1115333716 14:32224411-32224433 AAAGAGATGTAGCAGGAAAAAGG - Intergenic
1115456049 14:33603556-33603578 AAAGAGAAAGAGCAGCAAGAGGG + Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115931166 14:38496799-38496821 GAAGAGAAGGAGGAGGATGATGG - Intergenic
1116218056 14:42045678-42045700 AAGAATAAGCAGCAGGAGCATGG - Intergenic
1116233925 14:42253634-42253656 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116378880 14:44239760-44239782 AAAGAGCAAGGGCAGGAGGAAGG - Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116658225 14:47675992-47676014 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116733243 14:48653051-48653073 AATGAGAAGAATCAGGAGTAGGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117035699 14:51726415-51726437 AAAGAAAGGCAGGAGGAGGGAGG - Intronic
1117081290 14:52154797-52154819 AAAAGGCAGCAGCTGGAGGAGGG + Intergenic
1117097789 14:52315150-52315172 AATGAGAAGCAGCAGCAGGGTGG - Exonic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117432582 14:55683326-55683348 AAAGAGATGAAGCAGGTGGAGGG - Intronic
1117676054 14:58155940-58155962 GAAGAGAGACAGCAAGAGGAAGG + Intronic
1117761636 14:59035328-59035350 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117907300 14:60603663-60603685 AAAGATAAAAAGCAGGAGAAAGG + Intergenic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118459543 14:65976004-65976026 GAAGGGAAGCAGGAGAAGGAGGG + Intronic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118491604 14:66266275-66266297 AATGAAAAGTATCAGGAGGAGGG + Intergenic
1118623284 14:67633725-67633747 AAAGAGATGCGGCAGGAGCCGGG - Intronic
1118720177 14:68588382-68588404 AAAGTGAAATAGCAAGAGGACGG - Intronic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118767750 14:68921559-68921581 AAAGAGGAGGAGGAAGAGGAAGG + Intronic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119031437 14:71195927-71195949 CAAAAGAAGCCACAGGAGGAAGG - Intergenic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119184772 14:72632620-72632642 GAAGGAAAGAAGCAGGAGGAAGG + Intronic
1119205134 14:72788415-72788437 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1119216943 14:72876403-72876425 AAAGAGAGGCTCCAGGGGGAGGG - Intronic
1119379523 14:74219604-74219626 AATGAGGAGCAGCAGAAGGTGGG - Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119634443 14:76262642-76262664 AAAGAGGAGCAGCAGAAAGATGG + Intergenic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120009589 14:79398664-79398686 AAAGAGAAGCATCTGTTGGAGGG + Intronic
1120294525 14:82622979-82623001 AAAGAGGAGGAGGAGGAGAATGG + Intergenic
1120306763 14:82780824-82780846 AAAAAGAAGGAGGAGGAGAAGGG - Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1120765139 14:88322137-88322159 TCAGAGTAGAAGCAGGAGGAGGG - Intronic
1120808419 14:88777673-88777695 AAAGTTAAAAAGCAGGAGGATGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121171223 14:91856041-91856063 AAAAAGATGAAGCAGAAGGAAGG + Intronic
1121173490 14:91873254-91873276 AAAGATGAGGAGGAGGAGGATGG + Intronic
1121480407 14:94264890-94264912 AAAGAAAAGCAACAGAATGATGG + Exonic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121729584 14:96176949-96176971 ACAGAGGAGCAGGAGGAAGAGGG + Intergenic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1121735729 14:96216749-96216771 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1121749102 14:96332230-96332252 AAAGAAAAGCACCAGTAGAATGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122082438 14:99274772-99274794 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1122273441 14:100578666-100578688 CTAGAGAAGAAGCAGGAGGTTGG - Intronic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122413050 14:101535749-101535771 AAAGGGCAGCAGCAGGGGGTGGG - Intergenic
1122860937 14:104582114-104582136 ACAGAGAAACATCAGGAGGTGGG + Intronic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123539258 15:21271712-21271734 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
1123800312 15:23811950-23811972 AAAATGAAGAAGGAGGAGGATGG + Intergenic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124366676 15:29076857-29076879 AAAGAAAAGCAGCATGGGAAGGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124637328 15:31373555-31373577 AAGGAGAAGCAGGAGGAAAAGGG - Exonic
1124816787 15:33001709-33001731 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1124963510 15:34415970-34415992 AAAGAGAAGCTACATGAAGAGGG - Intronic
1124980131 15:34562196-34562218 AAAGAGAAGCTACATGAAGAGGG - Intronic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1125818526 15:42607497-42607519 AAAAAGAGGCATCAGGAGGGTGG - Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1126047874 15:44660776-44660798 AAAGGGAAGCGGGAAGAGGAGGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126362794 15:47863557-47863579 AAAGAGGAGAAGGAAGAGGAGGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1126744537 15:51812852-51812874 AAAGGGAAGCTGCAAGTGGAAGG - Exonic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126920550 15:53517807-53517829 AAAGAGAAAGACCAAGAGGAGGG + Intronic
1127165658 15:56243398-56243420 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1127692284 15:61409125-61409147 AAAAAGAAGTAGGAGGATGAGGG + Intergenic
1127747556 15:61995535-61995557 AGAGAGAAACTGCAGCAGGATGG - Intronic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128158990 15:65410788-65410810 AAAGAAAAGCAGAAGGAACAGGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338426 15:66803213-66803235 AAAAAGCAGCAGCAGCAGGAAGG + Intergenic
1128565088 15:68695804-68695826 AGAGAGAAGAAACAGGAGAAGGG + Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1128880396 15:71237093-71237115 CAAGAGATGCAGCAGGAGCCAGG + Intronic
1129699157 15:77757688-77757710 AAAGAGAGCCAGCAGGGGCAGGG + Intronic
1129809183 15:78493205-78493227 ATAGAGCACAAGCAGGAGGAAGG + Intronic
1130166221 15:81461612-81461634 AACGAGAAGCACCAGAAGTAAGG - Intergenic
1130341954 15:83007075-83007097 AAATAGAATCTGCAGGAGGGGGG - Intronic
1130349710 15:83080241-83080263 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1130681589 15:86001641-86001663 AAAGAGAAAGAGCAGGGGGAGGG - Intergenic
1130721103 15:86386264-86386286 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130795197 15:87200351-87200373 AAAGGAGAGCAGCAGGAGTAGGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014180 15:89043625-89043647 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131319790 15:91376351-91376373 AATGTGAAGAAGTAGGAGGAAGG + Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131757102 15:95576779-95576801 ACAGAGAAGCATCATGAGCAAGG - Intergenic
1131790417 15:95958441-95958463 AAGGAGAAGCATCTGGAGGCTGG - Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1131852134 15:96554695-96554717 AAAGAGGAAGAGGAGGAGGAGGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1131951222 15:97683707-97683729 AAAGAGAAGGGGGAGGGGGAGGG + Intergenic
1132013520 15:98296479-98296501 AAAGAGAGACAGCAGGAGAAAGG - Intergenic
1132080554 15:98861352-98861374 AAAGAGAAGGACTAGGAGGGCGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1132722790 16:1325189-1325211 AGAGAGGAGCGGCAGGAGGGAGG - Exonic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133794641 16:9035897-9035919 AAAGTGTAGGGGCAGGAGGAGGG + Intergenic
1133821373 16:9239704-9239726 AAAGAAATGCAGGAGGAGAAGGG - Intergenic
1134008947 16:10836925-10836947 ACAGAGAAGAAGCAAGAGTAGGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134105585 16:11483969-11483991 ACAGAGGAGAAGCAGGAGGAAGG + Intronic
1134324286 16:13192880-13192902 AAAGAGAAGAAGAAGAAAGAAGG + Intronic
1134751910 16:16631860-16631882 AGAGAGAATGAGCAGGAGCAGGG - Intergenic
1134993560 16:18721843-18721865 AGAGAGAATGAGCAGGAGCAGGG + Intergenic
1134997410 16:18750660-18750682 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1135938385 16:26800098-26800120 AAATAGAAGTTGCTGGAGGATGG + Intergenic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1136777556 16:32879867-32879889 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1136893068 16:33981647-33981669 AAACAGAAGTAGTAGGAGGCTGG - Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137557099 16:49477407-49477429 AAAGAGGAAGAGGAGGAGGAAGG + Intergenic
1137590018 16:49687736-49687758 AAACAGGAGCCGCAGCAGGACGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137962509 16:52897201-52897223 AAAGGGGAGAAGGAGGAGGAGGG + Intergenic
1138217369 16:55215950-55215972 AAAGATATGCAGTCGGAGGAAGG - Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138395351 16:56700030-56700052 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138454155 16:57111810-57111832 AAAGAGTTGCAGCTTGAGGAAGG + Intronic
1138528196 16:57620781-57620803 GAAGACAAGCAGCCGGTGGAGGG - Intronic
1138765473 16:59597423-59597445 GAAGAGAAGAAGCACGAGAATGG - Intergenic
1138894803 16:61190713-61190735 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1138955113 16:61962155-61962177 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139160767 16:64506192-64506214 AAAGATGAGCAGCAAGAGAAAGG - Intergenic
1139165587 16:64561473-64561495 AAAGAGGAGGAGGAGGAAGAAGG + Intergenic
1139349033 16:66323679-66323701 AAAGAGAAGCAGGGGAGGGAGGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1139946386 16:70645155-70645177 GAAGAGAAGGAGGAAGAGGAAGG + Intronic
1139956226 16:70694281-70694303 ACAGACCAGCAGCAGGAGCAGGG + Intronic
1139973371 16:70790345-70790367 AAAGAAAAGCCACAGGTGGAGGG + Intronic
1139976356 16:70814325-70814347 ATAGAGGAAAAGCAGGAGGAAGG + Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140092326 16:71848916-71848938 AAAAAGAGCCAGCAGGAGGCTGG + Intronic
1140258061 16:73353747-73353769 AAAAAGAGGCAGGAGGAGAAAGG + Intergenic
1140413554 16:74756545-74756567 AAAGAAAAGGAACAGGAGGTGGG - Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140916730 16:79500513-79500535 AGAGAGAAGAAGGAGTAGGATGG - Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141000229 16:80300860-80300882 AAAGAGGAGAAGGAAGAGGAGGG - Intergenic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141898404 16:86973660-86973682 ACAGAGAAGCAGCAGAAGGGTGG + Intergenic
1142035672 16:87861033-87861055 AAAGGGCAGCAGCGGGAAGAGGG + Intronic
1142431349 16:90029631-90029653 AACAAGAAGGAGCAGCAGGAGGG - Intronic
1203079970 16_KI270728v1_random:1141976-1141998 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1142492203 17:286404-286426 ACACTGAAGCAGCAGGGGGATGG - Intronic
1142643374 17:1297559-1297581 AATAACAAGCAGCAGCAGGATGG - Intronic
1142704244 17:1684471-1684493 GAGGAGAAGCTGCAGGAGAAAGG - Exonic
1142767249 17:2071786-2071808 AAAGAGTGGCAGGCGGAGGAGGG + Intronic
1142944512 17:3413189-3413211 GGAGAGAAGCAGCAGGAGGGAGG + Intergenic
1143171370 17:4932508-4932530 GAAGCGAAGCTGCAGGGGGAAGG + Intronic
1143173624 17:4944358-4944380 AAAGAGAAGCAGAGGTAAGAAGG - Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143443528 17:6994165-6994187 AAACAAAAGCAGGAGGGGGAAGG + Intronic
1143514469 17:7412966-7412988 AAAGGGAAGGAGCAGGAAGAGGG - Intronic
1143673732 17:8415119-8415141 AGAGAGAAGAGGCAGGAGGGAGG - Intronic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144152206 17:12459768-12459790 ACAGAAAAACAGCAGCAGGAGGG + Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144401287 17:14905005-14905027 AAAGAGAAGCACCAGGAAGGTGG + Intergenic
1144479567 17:15617680-15617702 CAAGAGAAGTAGCAAGAGAAGGG - Intronic
1144540087 17:16132913-16132935 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1144589789 17:16514387-16514409 AAAGAGAAGCGAGAGGAGCAAGG - Intergenic
1144761142 17:17708148-17708170 AGAGGGTGGCAGCAGGAGGAAGG - Intronic
1144840338 17:18182243-18182265 AAAAAGAACGAGGAGGAGGAGGG + Intergenic
1144918735 17:18746059-18746081 CAAGAGAAGTAGCAAGAGAAGGG + Intronic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145097662 17:20045200-20045222 AAACTCAAGCAGCAGCAGGATGG - Intronic
1145751942 17:27361509-27361531 AAGGAGAGGCAGCAGGATGGAGG - Intergenic
1145830595 17:27913210-27913232 AATGTGAGGCAGCAGTAGGAGGG - Intergenic
1145980400 17:29007765-29007787 AGAGGGCAGCAGCAGAAGGATGG + Intronic
1146083725 17:29807728-29807750 AAAGATAAGCTGCAGGAGACAGG + Intronic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1146642105 17:34549310-34549332 GAAGAGTAGGAGCAGGAGAAGGG + Intergenic
1146645432 17:34573977-34573999 CAAGAGAAGCATCAGGGGCATGG + Intergenic
1146679956 17:34799919-34799941 TTAGAGAACAAGCAGGAGGAAGG - Intergenic
1146835099 17:36104542-36104564 TAAGAAAAGCAGCAGGCGGTGGG - Exonic
1146849714 17:36211790-36211812 TAAGAAAAGCAGCAGGCGGTGGG - Exonic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147041327 17:37721588-37721610 AAAGAGAAGCAGCCGGGGTGAGG - Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147383384 17:40068728-40068750 AAAGAGGAGGAGGAGGAGGTGGG - Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147720537 17:42536941-42536963 AAAGAGAAGGTGGGGGAGGAAGG - Intronic
1148069173 17:44897316-44897338 GAAGAGAAGAAGCAGGTGCATGG - Intronic
1148114708 17:45168990-45169012 AAAGAGAGGGAGGAGGAAGAAGG - Intronic
1148149659 17:45389133-45389155 AAAGGGGAGGAGGAGGAGGATGG + Intergenic
1148239863 17:45993164-45993186 AAAGACACGCAGCAGGTGGTGGG - Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148890111 17:50801065-50801087 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149467744 17:56893125-56893147 ACACAGATGCAGCAGGAGAAGGG + Intronic
1149524292 17:57341906-57341928 AAAGAGAACAAGGAGGAAGAAGG - Intronic
1149546289 17:57506214-57506236 AAAGAGAAAGAGCCGGAGCAGGG - Intronic
1149578304 17:57729247-57729269 GAAGAGAAGGAACAGGTGGAAGG - Intergenic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150442439 17:65202476-65202498 AGAGAGAAGAAGCAGCAAGATGG + Intronic
1150457043 17:65314454-65314476 AAAGAGAAGCAGCAGACAGAGGG - Intergenic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151355771 17:73557636-73557658 AGAGAGGAGGAGGAGGAGGATGG - Intronic
1151568635 17:74915019-74915041 AACCAGAGGCAGCAGGATGAGGG - Intergenic
1151618162 17:75228254-75228276 AAAGAGAAGTACCATGAAGAGGG + Intronic
1151757229 17:76081894-76081916 GAAGAGCAGCAGCAGCAGGATGG - Exonic
1152009763 17:77705172-77705194 AAAGACTACCAGGAGGAGGAAGG - Intergenic
1152043045 17:77917423-77917445 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1152124550 17:78438425-78438447 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152297549 17:79476942-79476964 GAAGAAAAGGAGGAGGAGGAAGG + Intronic
1152315955 17:79580279-79580301 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
1152334175 17:79690870-79690892 GGAGAGAAGGAGCAGAAGGAGGG + Intergenic
1152601514 17:81264572-81264594 AGAGAGAAGCACCAGGGGCAGGG + Intronic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153448155 18:5196797-5196819 GAAGAGAAGCAGCGGGACGAGGG + Intronic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153460580 18:5328397-5328419 AAAAAGAAGAAGAAGAAGGAAGG + Intergenic
1153463276 18:5361180-5361202 AGGGAGAAGAAGCAGGAGTATGG + Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155109906 18:22704067-22704089 AGAGAGAATCTACAGGAGGAAGG - Intergenic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155324376 18:24651277-24651299 TAAGAGGAGCTGCAGGAGTAGGG + Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155409880 18:25532140-25532162 AAAGAGAAGCAACAGGAAGAGGG + Intergenic
1155505455 18:26528549-26528571 GCAGAGCAGCAGCTGGAGGAAGG - Intronic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155898837 18:31362716-31362738 GAAGGAAAGCAGCAGGAGGTAGG + Intergenic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156156029 18:34302657-34302679 AAGGAAAAGCAGCAAGAGAAAGG + Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156315449 18:35965087-35965109 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156801551 18:41120960-41120982 AATGACAAACACCAGGAGGAAGG + Intergenic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157376069 18:47166535-47166557 AAAGAGGAGGGGGAGGAGGAAGG + Intronic
1157400426 18:47382423-47382445 AGAGAGAAGCTGCAGCAGAAAGG - Intergenic
1157711359 18:49851987-49852009 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1158084927 18:53639869-53639891 AGATAGAAGCAGCAGGAGCCTGG - Intergenic
1158085312 18:53643950-53643972 AAAGGGAAGCAAAAGGAGTAAGG - Intergenic
1158190537 18:54823310-54823332 ACAGAAAATCAGCAGGAGGTAGG + Intronic
1158217774 18:55117724-55117746 AAAAAGTAGAAGAAGGAGGAGGG + Intergenic
1158536888 18:58316259-58316281 AAAGAGAGGGAGCTGGTGGATGG - Intronic
1158610156 18:58932462-58932484 AAAGAGAAGCAGCAGGGGAGGGG + Intronic
1158875148 18:61726475-61726497 AAAGAGGAGGAGGAGGAAGAGGG + Intergenic
1159079793 18:63724254-63724276 ACAGAGGAGGAGGAGGAGGAAGG - Intronic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159944185 18:74431485-74431507 AAATACAAGGAGCAGAAGGAAGG + Intergenic
1160254226 18:77233865-77233887 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161370514 19:3908577-3908599 GAAGAGGAGGAGGAGGAGGACGG - Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161777082 19:6269502-6269524 AAAGAGAAGCCGCAGGCTGAGGG + Intronic
1161795054 19:6381562-6381584 AAGGCGCCGCAGCAGGAGGAGGG - Exonic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162339205 19:10081732-10081754 GAAGAGAAGGAGGAGGAGGGAGG + Intergenic
1162393045 19:10401255-10401277 AGAAAGAAGCAGCAAGAGGTGGG + Intronic
1163175823 19:15563597-15563619 ACAAAGAAGCCCCAGGAGGAGGG + Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163548471 19:17952442-17952464 AAAGGGGAGCTGCGGGAGGAGGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164234942 19:23323623-23323645 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164475721 19:28574518-28574540 ACATGGAAGGAGCAGGAGGAAGG - Intergenic
1164718454 19:30412667-30412689 AAAGAGGAGAAGAAGGAGAAGGG - Intronic
1164858637 19:31544966-31544988 AAAGAGAAGGAGGAGGAGGGAGG - Intergenic
1164858645 19:31545018-31545040 AAAGAGAAGAAGGAGGAGGGAGG - Intergenic
1164868643 19:31625649-31625671 AAAGAGAAACATGAGGGGGAGGG - Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165384605 19:35502942-35502964 ATAGGGCAGTAGCAGGAGGAGGG - Intronic
1165598402 19:37031463-37031485 AAAGAGAAGCAAGGAGAGGATGG - Intronic
1165757933 19:38304902-38304924 AAAGTGAAGAAGAAGGAGAAGGG + Exonic
1166008634 19:39925157-39925179 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166047495 19:40238083-40238105 GAAGAACAGCTGCAGGAGGAAGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166382485 19:42362235-42362257 GATGAGAAGCAGCAGGTGTAGGG + Intronic
1166531097 19:43544036-43544058 AAAGAAGACCATCAGGAGGATGG - Intronic
1166635995 19:44452402-44452424 AGAGAGGAGCAGGAGGAGCACGG + Intergenic
1166814064 19:45531512-45531534 AAAGAGGAGGAGCAGTATGAAGG - Intronic
1166818857 19:45564147-45564169 AAAGAGAAGCATCAGGGTGGGGG + Intronic
1166922543 19:46240055-46240077 AAAGAGAAGCAGCTGTAAAATGG - Intergenic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167191308 19:47991808-47991830 GAAGAGAGGAAGGAGGAGGAGGG - Intronic
1167240928 19:48342560-48342582 GAAGAGCAGCAGCAGCAGGGAGG + Exonic
1167452000 19:49576331-49576353 AAAAAAAAGCAGCAGCAGCATGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167758895 19:51430983-51431005 AAAGAGAAAGAGTAGGAGGCTGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167839417 19:52102317-52102339 AAATAGAAGTAGCTGGAGAAAGG - Intergenic
1168209039 19:54875668-54875690 AAATAGAATCAGCATAAGGAAGG - Intronic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925147447 2:1590731-1590753 AAAGCACAGAAGCAGGAGGAAGG + Intergenic
925156426 2:1651768-1651790 AGAGAGAAACAGCAGGCGGGAGG - Intronic
925260556 2:2524889-2524911 AATGAGACCCAGCAGGAGCAGGG - Intergenic
925605265 2:5653972-5653994 ATAGCCAAGCAGCAGGAGTAGGG - Intergenic
925718787 2:6808782-6808804 AAAGAGAAAGGGGAGGAGGAGGG + Intergenic
925831372 2:7899269-7899291 TATGAGTAGGAGCAGGAGGAAGG - Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
926243809 2:11107399-11107421 AAAAAGAAGGAGGAGGAGAAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926591013 2:14740316-14740338 GAAGAAGAGAAGCAGGAGGAGGG + Intergenic
926861520 2:17315249-17315271 AAATACCAGCAGCAGGAGGAGGG - Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927415427 2:22874363-22874385 AAAGAGATGCAGCTGGAGAGGGG - Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927647018 2:24884281-24884303 GAAGAGAATCACCTGGAGGAGGG - Intronic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927786852 2:25980678-25980700 GAAGAGCAGCCGCAGGAAGAAGG - Exonic
928363110 2:30681277-30681299 AAAGAGAGGGAGCAGGAGAGAGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929137452 2:38638057-38638079 AAAGAGAAGAGACAGGAGGGAGG + Intergenic
929171391 2:38936393-38936415 AAACAGAAAGAGGAGGAGGAAGG - Intronic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929347230 2:40899666-40899688 AAGGAGAAGCATCAGGGGTAAGG - Intergenic
929578592 2:43068062-43068084 AAAGAGAAACAGCCGGCGGGTGG + Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930001787 2:46866593-46866615 AAAGATAAGAAGCTGGAGGTTGG + Intergenic
930329399 2:49963410-49963432 CAAGAGAATGAGCAGAAGGAAGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
930673710 2:54177874-54177896 AAAGAAAAGAAACAGGAGGCCGG - Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931473441 2:62563830-62563852 AAAGTGAAGTAGAAGGAGGCAGG + Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931902756 2:66807544-66807566 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
931992766 2:67807740-67807762 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
932149592 2:69357567-69357589 AAAAAGAGGAAGCAGGAAGATGG - Intronic
932283284 2:70512923-70512945 AATCAGGAGGAGCAGGAGGAAGG + Intronic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932453741 2:71832821-71832843 AAAGAGAAGGAGCTAGAGAAGGG + Intergenic
932460692 2:71880064-71880086 GAAGGGAAGAAGCTGGAGGAAGG - Intergenic
932614922 2:73225878-73225900 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
933105206 2:78316075-78316097 AAAGAGAGGCAGTAAGAGGTAGG + Intergenic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
933998230 2:87685637-87685659 AAAGAGGGGCAGCTGAAGGAAGG + Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934165308 2:89288888-89288910 AAAGAGCAGCAGCATGACCATGG - Intergenic
934526480 2:95055273-95055295 AAAAAGAAGAAGAAGAAGGAGGG + Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934653104 2:96103550-96103572 TATGAGGAGCAGCAGCAGGAGGG - Intergenic
934653205 2:96104077-96104099 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934759583 2:96846441-96846463 ACAGAGCAGAAGCAGGAGGGTGG - Intronic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934926553 2:98385842-98385864 AAACGGCAGGAGCAGGAGGAAGG + Intronic
935233864 2:101121646-101121668 AAACAGAAACACCAGCAGGATGG - Intronic
935346900 2:102116707-102116729 AAACAGCAACAGCAGCAGGAAGG + Intronic
935403406 2:102683730-102683752 AAAGAGAAACAGGAGGATGGAGG - Intronic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936295620 2:111265236-111265258 AAAGAGGGGCAGCTGAAGGAAGG - Intergenic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936523962 2:113230280-113230302 AACGAGAAGGAACAGGATGAAGG - Intronic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
937002878 2:118484309-118484331 AAACAAAGGCAGCAGGACGAGGG - Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937250566 2:120521245-120521267 AAAGAGAAGGCTCAGGAGAATGG + Intergenic
937251205 2:120524923-120524945 AAAGGGAAACAGCAGGTAGAGGG - Intergenic
937285258 2:120746524-120746546 AAACAGAAGCAGAAGAAAGAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937546703 2:123030894-123030916 GAAGAGAAGGAGGAAGAGGAGGG - Intergenic
937579086 2:123461538-123461560 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937689725 2:124741814-124741836 AGAGAGAATAAGGAGGAGGAGGG - Intronic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938312944 2:130305928-130305950 AAACAGAGGAAGCAGGAGAATGG + Intergenic
938411400 2:131067775-131067797 ACAGAGAAAAAGCAGCAGGAAGG + Intronic
938654763 2:133419738-133419760 AAATAGAAGCAGCATGTGGTAGG - Intronic
938736611 2:134191731-134191753 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939054835 2:137352160-137352182 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940409357 2:153342678-153342700 GAAGAGGAGCAGGAAGAGGAGGG - Intergenic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
940945697 2:159615620-159615642 AAAGGGCAGCAGGAGGCGGACGG + Intronic
941065965 2:160903123-160903145 AAAGAGAATAAGCATGAAGAAGG - Intergenic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941098879 2:161275204-161275226 AAAAAGAAGTAGCACGAGAATGG + Intergenic
941315450 2:163986400-163986422 AAAGGGAAGGATAAGGAGGAAGG + Intergenic
941712752 2:168731615-168731637 AAGGAGAAGTAGCAGGGGGTGGG + Intronic
941884697 2:170515894-170515916 AAAGAGAAGTAGCAGGATCCAGG + Intronic
942348582 2:175029210-175029232 AAATAGAGGCAGCAAGAGGGGGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942524809 2:176841808-176841830 AGAGAGGAGGAGGAGGAGGAAGG - Intergenic
942779332 2:179622805-179622827 AAAGAGAAGCAGCTGTAGAGAGG + Intronic
942874362 2:180776149-180776171 AAAGAGAAAGAGTAGAAGGAAGG - Intergenic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943357111 2:186870442-186870464 AAAGAGAAGGAGGAGGAGAAAGG - Intergenic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
943834366 2:192500424-192500446 GAGGAGAAGCAGCTGGATGATGG + Intergenic
944321369 2:198347606-198347628 AAATAAAAGCAGCAGGCAGACGG - Intronic
944589558 2:201204170-201204192 GGAGAGAAGAAGCAAGAGGAGGG + Intronic
945158324 2:206862325-206862347 AGAGAGCAGCTGCAGGAGGTGGG + Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945389579 2:209247659-209247681 ATAGAAAAGCAACAGGAGGCCGG + Intergenic
945502499 2:210593372-210593394 AAACAGCAGCAGGAGAAGGAGGG + Intronic
945517050 2:210775281-210775303 CAAGAGCAGCACTAGGAGGATGG - Intergenic
945714241 2:213337595-213337617 AAAGAGACGAAGCAGAAGAAAGG + Intronic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946059241 2:216927472-216927494 AAAATGAGGAAGCAGGAGGAGGG + Intergenic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946192724 2:218016019-218016041 AAAGTGCAGGAGAAGGAGGAAGG + Intergenic
946217682 2:218198276-218198298 GGAGAGAAGCGGGAGGAGGAAGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946363823 2:219236232-219236254 AAACAGAAATGGCAGGAGGAGGG + Intronic
946366133 2:219250217-219250239 ACAGAGCAGCAGCAGCATGAAGG + Exonic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946507835 2:220320549-220320571 AAACATAAGCTCCAGGAGGATGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946856843 2:223958188-223958210 AAAGAGAAAAAGCAAGATGAAGG - Intronic
947066954 2:226237807-226237829 AAAAAGGGGGAGCAGGAGGAAGG + Intergenic
947217146 2:227759814-227759836 AAAGAGAAGCAGCGGAGGGGTGG - Intergenic
947275265 2:228384542-228384564 AAAGAGAAACAGCAAGAATATGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947420003 2:229933562-229933584 AAAGAGAAGCATCATGAGCCGGG + Intronic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947830187 2:233134144-233134166 AAAGTCAAGGAGGAGGAGGAAGG + Intronic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
948069716 2:235110642-235110664 AAAGAGAACAAAAAGGAGGAAGG + Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948272527 2:236685637-236685659 ACAGAGAGGCAGCTGAAGGAGGG - Intergenic
948375737 2:237519199-237519221 AAGGGGAAGCAGCTGGAAGAAGG + Intronic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948617017 2:239205684-239205706 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168972530 20:1940389-1940411 AAAGTGAGGCCCCAGGAGGAGGG - Intronic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169687874 20:8296588-8296610 AAAAAGAAGGAGCAGAGGGATGG + Intronic
1169745574 20:8939211-8939233 TGAGAGCAGCACCAGGAGGATGG + Intronic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1169830422 20:9819295-9819317 AAATAGAAGCAGCAGTACAATGG + Intronic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170754279 20:19185020-19185042 AAAGAGAGGGAGCGGGATGAGGG + Intergenic
1170779626 20:19412611-19412633 CAAGAGGAGGAGGAGGAGGAGGG + Intronic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1171040596 20:21758932-21758954 AAAGAGAGTGAGCAGCAGGAAGG - Intergenic
1171059906 20:21946078-21946100 AAAGAGAAGGACCAGAAGGCAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172260708 20:33562347-33562369 AGAGAGAGGAAGCAGGAGGGAGG + Exonic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1172939322 20:38643836-38643858 AAGGAGAAGCAGCTGGCAGAAGG + Exonic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173037190 20:39423680-39423702 AAAGAGACACAGCACAAGGAGGG - Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173344285 20:42184499-42184521 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1173345796 20:42198933-42198955 AAAAAGAAAGAGGAGGAGGATGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173836255 20:46128198-46128220 AAAGACCAGCACCAAGAGGATGG - Exonic
1174035835 20:47667794-47667816 AAAGAGGACCAGCTGGAGGCAGG + Intronic
1174579826 20:51563413-51563435 GAAGAGGAGAAGGAGGAGGAAGG + Intergenic
1174663027 20:52231583-52231605 AAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1174720263 20:52804040-52804062 AATGAGAAGCAGCAGCCGGCTGG + Intergenic
1174898565 20:54475573-54475595 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1175014557 20:55775341-55775363 TAAGATAAGCATCAGGAGGATGG - Intergenic
1175226154 20:57445070-57445092 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1175429383 20:58891271-58891293 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175649124 20:60701953-60701975 CAAGAGCAGCAACAAGAGGATGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175929702 20:62487874-62487896 GAAGAGAAAGAGCAAGAGGAAGG - Intergenic
1176387602 21:6146572-6146594 AAACAGAAGCAGTAGGAGACGGG + Intergenic
1177090432 21:16760682-16760704 AAAGAGACACTGCAGAAGGAAGG + Intergenic
1177149348 21:17438962-17438984 AATGAAATGCAGCTGGAGGATGG - Exonic
1177201783 21:17965439-17965461 GAAGAGGAGGAGGAGGAGGATGG - Intronic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1177758325 21:25373733-25373755 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1177836382 21:26190095-26190117 AAAGAGAAGCAAGCAGAGGAGGG + Intergenic
1177930572 21:27277973-27277995 AAAGAGAAGTGTGAGGAGGAGGG - Intergenic
1178038756 21:28615337-28615359 GAAGAGAAGGAAGAGGAGGAGGG - Intergenic
1178305688 21:31488435-31488457 AAAGAAAAGGAAGAGGAGGAAGG + Intronic
1178375539 21:32064598-32064620 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1178440117 21:32591807-32591829 GAAGAGTTGCAGCAGGAAGAGGG - Intronic
1178685347 21:34706319-34706341 AAAGGGCAGCAGCAAGGGGATGG + Intronic
1178691869 21:34756477-34756499 TATGGGAAGCAGCAGGATGAAGG - Intergenic
1178813485 21:35905731-35905753 AAACAGAAAAAGCAGAAGGAAGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179548613 21:42128548-42128570 ATAGAGAAGCAACACAAGGAAGG + Intronic
1179652137 21:42818438-42818460 GAAGCGCAGCAGCAGGAGGAGGG + Intergenic
1179735870 21:43391676-43391698 AAACAGAAGCAGTAGGAGACGGG - Intergenic
1180219592 21:46349803-46349825 AAAGAAAAACAGCTGGAGGTGGG + Exonic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1181329089 22:22075196-22075218 AGAGAGAAACAGCAGGAGAGGGG - Intergenic
1181403423 22:22665597-22665619 AGAGAGAACCAGCAGGAGCCAGG + Intergenic
1181408426 22:22701582-22701604 AGAGAGAACCAGCAGGAGCCAGG + Intergenic
1181413749 22:22745081-22745103 AGAGAGAACCAGCAGGAGCCAGG + Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181885314 22:26017386-26017408 AAAGAGAAGGGAGAGGAGGAAGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182550033 22:31095943-31095965 AGAGAGGAGCAGCAGGGAGAAGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182755876 22:32678530-32678552 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182942357 22:34288949-34288971 AAAGAGGAGGAAGAGGAGGAAGG - Intergenic
1183385404 22:37511373-37511395 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1183480587 22:38062601-38062623 AAAGAGAAGGGGCAGGGGCAGGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183864027 22:40690179-40690201 GAAGAGAGGCAGCCGGGGGATGG - Intergenic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184281754 22:43441410-43441432 TCACAGAAGCTGCAGGAGGAAGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184379518 22:44136336-44136358 AAAGAGCAACAGGAGAAGGAGGG - Intronic
1184390469 22:44200662-44200684 AAAGAGGTGAAGCAGGAGGCAGG + Intronic
1184632769 22:45797172-45797194 AAAGAAAAGCAGGAGGAATATGG + Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184899014 22:47432663-47432685 AAAGAGAAGAAGGAAAAGGAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1184989903 22:48160292-48160314 AGAAAGAAGAAGGAGGAGGAGGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949395939 3:3614854-3614876 AGAAAGAAGAAGCAGAAGGAAGG - Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
950401660 3:12773736-12773758 GAAGAAAAGGAGCAGGAGGAAGG + Intergenic
950426529 3:12927528-12927550 AAAGAGCAGCGGCAGAAGGCGGG - Intronic
950575976 3:13832260-13832282 GAAGAGGAGGAGCAGGAGGATGG - Intronic
950814806 3:15689493-15689515 CAAGAGAGGCCACAGGAGGAAGG + Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
951128625 3:19014351-19014373 AAAGAGATGGAGGAGGAGAATGG - Intergenic
951455801 3:22890892-22890914 AAAGTGGAGGAGGAGGAGGAAGG - Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951914861 3:27789656-27789678 AGAGAGAAGCAGCAGAATGGTGG - Intergenic
952843976 3:37671308-37671330 AAACAGATGAGGCAGGAGGAGGG + Intronic
953411470 3:42692746-42692768 AAAGAGAAGCCGGAGTAGGAGGG - Exonic
953450476 3:43001275-43001297 CAAGAAAAGCAGCAGCTGGAAGG - Intronic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
953886602 3:46717732-46717754 CAACAGAAGCAGCAGCAGCAGGG + Exonic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954003042 3:47572757-47572779 GAAGAGCAGGAGCAGGACGAGGG + Exonic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954214981 3:49119673-49119695 AAATAGAAGGTGGAGGAGGAAGG + Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954706417 3:52483167-52483189 GAAGCGAAGCAGCAGGGGGTAGG - Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954995036 3:54873354-54873376 AAAGTGAAGAAGGAAGAGGAAGG - Intronic
955069607 3:55561133-55561155 AAAGAAAAGCAGCAGTAGTTTGG - Intronic
955171415 3:56569187-56569209 AGAGAGAAGCAGCAGAAATAAGG + Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955639859 3:61070611-61070633 GAAGAGAAGGAGCAGAAGGCAGG - Intronic
955641642 3:61091959-61091981 AAAAAGAAGCAACAGGAGTCAGG + Intronic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
956310835 3:67877814-67877836 AAAGAGAAGGAGGAGAGGGAGGG - Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956945078 3:74212287-74212309 AAAAAGAAGTAGCATGAAGATGG - Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957290397 3:78271019-78271041 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957956247 3:87191390-87191412 AAAGTGAAGCAACAGATGGAGGG - Intergenic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958415387 3:93867691-93867713 AAAGTGAGGCAGGAGGAAGAGGG - Intergenic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
959228952 3:103621872-103621894 AAAGAGAGGGAGCAAGAGAAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959437211 3:106330613-106330635 AAACAGAACCAGCAGGAGGTAGG - Intergenic
959561947 3:107792189-107792211 AAAGAGAATCAACAGGAAGAAGG - Intronic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959665589 3:108917444-108917466 TAATAGAAGCAGCAGGATCAGGG + Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959844060 3:111012767-111012789 GCAGGGAAGCAGCAGGAGCAGGG - Intergenic
959971765 3:112417533-112417555 AGACATAAGCAGCAAGAGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960166570 3:114409490-114409512 AAACAGAAGCAGCTGAAGGAAGG + Intronic
960331842 3:116369565-116369587 AAAGAAAAGGAGGAAGAGGAGGG + Intronic
960455846 3:117870438-117870460 AAAGAGAAGAAGGAGGAGTTTGG - Intergenic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
960912772 3:122665938-122665960 AAAGAGAAGCAGTAGGGGCCTGG + Intergenic
961236945 3:125375261-125375283 GAAGAGGAGGAGGAGGAGGAGGG - Exonic
961316166 3:126037188-126037210 CAAGAGAGGGAGCAGGAGAAGGG - Intronic
961513211 3:127416499-127416521 AATGAGAAGGGGGAGGAGGAGGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962769688 3:138600898-138600920 AAAAAGAAGGAGGAGAAGGAGGG + Intergenic
962770423 3:138606252-138606274 AAGGAGGAGGAGCAGGAGAAAGG + Intergenic
962963447 3:140332322-140332344 AAAGAGATGAAGCTGGGGGAGGG + Intronic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
962989591 3:140566152-140566174 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963794031 3:149613406-149613428 AAAGACAAGCAGCAAGATGAAGG + Intronic
963822261 3:149910261-149910283 AAAGAAAATCAGCAGCAGCAGGG - Intronic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964374412 3:156035469-156035491 AAAGAGAAGAAGGAAGAAGAAGG - Intergenic
964406271 3:156352243-156352265 AAAGGGAGGCAGCCAGAGGAAGG - Intronic
964430028 3:156595613-156595635 AAAGAGAGGCAGTGGAAGGAGGG - Intergenic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964484246 3:157171277-157171299 AAAGAGAACCAGCTGGAGAATGG + Intergenic
964649732 3:158996963-158996985 ATAGAGAAGCAGCAAGATAAAGG - Intronic
964650214 3:159003212-159003234 AAAGAGAAGCACCAGGTCTATGG + Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965151398 3:164981293-164981315 AAACAGCAGTAGCAGTAGGATGG + Intronic
965301853 3:167014855-167014877 AAAGATAAGCAGCAGGGACAGGG + Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965580972 3:170267375-170267397 AAAGAAAAGCAGTAGTAGGCCGG + Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559173 3:181300003-181300025 AATGAGAAGGAGGAGGAGAAGGG + Intergenic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
967319134 3:188178279-188178301 AAAGAGGAGAAGCATGAGGAGGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967638288 3:191831206-191831228 AAAAAGAAGCAGCAGCAGCTAGG + Intergenic
967742730 3:193021123-193021145 AAAAAGCAGCAGCAGCAGCATGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
968855919 4:3121939-3121961 AGAGAAAAGAATCAGGAGGAGGG - Intronic
968914457 4:3491216-3491238 AAAGAGCAGCGGGAGAAGGAAGG - Intronic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969928080 4:10603951-10603973 AATGAGAAGGAGCAGAAAGAAGG + Intronic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970099156 4:12501382-12501404 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970781034 4:19737947-19737969 AAAGAGAAGCAGCAGAATCTAGG - Intergenic
970839164 4:20446428-20446450 AGAGAGAAGCAGCAATAGTAGGG + Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971055949 4:22912548-22912570 AAAGTGAAGCAGGAGGATAAAGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971646319 4:29209246-29209268 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
971648748 4:29243262-29243284 AAAAAGAAGGAGGAGGAGAAGGG + Intergenic
971916141 4:32872208-32872230 AAAGATAAGACTCAGGAGGAGGG - Intergenic
972380929 4:38519706-38519728 AAAGAGACTCAGCTGGAGGGAGG + Intergenic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973840662 4:54857169-54857191 AGAGAGAAGCAACAGCAGCATGG + Intergenic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
973987915 4:56373505-56373527 AAAGAGAAGCAAGAGAAAGAAGG + Intronic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974207605 4:58726502-58726524 AAAAATCAGAAGCAGGAGGAAGG + Intergenic
974229280 4:59088959-59088981 AAAAAGAAGAAGGAGGAGGGGGG - Intergenic
974381567 4:61147035-61147057 AAAGAGAAAGAGCACAAGGAAGG + Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974677223 4:65108426-65108448 AAAGAGAAGCAGAAGCACTATGG - Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
974926537 4:68305630-68305652 AAAGAGGAGGAGGAGAAGGAAGG + Intergenic
974983826 4:68994317-68994339 AAAGAGGAAGAGGAGGAGGATGG - Intergenic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976172064 4:82314569-82314591 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
976293812 4:83449379-83449401 AGAGAGAAGCAGGGGAAGGAGGG + Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976695800 4:87918705-87918727 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
976709255 4:88051578-88051600 AAATAAAAACAGCAGGATGAAGG + Intronic
976709367 4:88052787-88052809 AGAGGGAAGGAGCAGGTGGAGGG + Intronic
976777162 4:88719484-88719506 AAAGAGGAGGAGGAGGAGAAGGG - Intergenic
977340917 4:95756422-95756444 AAACAGAAACAGCAGCATGAAGG - Intergenic
977722350 4:100254396-100254418 AAAGGGAAGGAGCATGAGCAGGG + Intergenic
977862451 4:101980526-101980548 AAAGAAGAGCAACGGGAGGAGGG - Intronic
977980721 4:103318264-103318286 AAGGAGAAGGAGGAGGAGCAGGG - Intergenic
978052802 4:104223253-104223275 AAATAGAAGTAACAGGAGAATGG - Intergenic
978168605 4:105640569-105640591 AAAGAGAATCTCCAGGATGATGG - Intronic
978168725 4:105642666-105642688 AAAGAGAATCTCCAGGATGATGG + Intronic
978702307 4:111662589-111662611 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
979071692 4:116215759-116215781 AATGAGAAGCAGCTGCAGTAGGG + Intergenic
979468580 4:121070554-121070576 GAAGCGAGGCAGCAGGAGGAGGG + Intronic
979480863 4:121215606-121215628 AAAGAGAAACAGGAGAAAGATGG - Intronic
979481190 4:121219330-121219352 AAAGAGGAAAAGGAGGAGGAGGG - Intronic
980082107 4:128355079-128355101 TGAGAGAGGCAGCAAGAGGAAGG - Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980431231 4:132699133-132699155 AACGAGAAGCTGCATGAAGAGGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980855695 4:138436661-138436683 AAAGAGGAGAAGCATGTGGAAGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981692529 4:147525604-147525626 AAAAAGCAGCAGCAGGAGAGGGG + Intronic
981915491 4:150028028-150028050 AAAAAGAAGGAGCAAGAGCAGGG - Intergenic
981989881 4:150905363-150905385 AAAGAGAGAGAGCAGGAGCAGGG + Intronic
982196939 4:152925876-152925898 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982405553 4:155016003-155016025 GCAGAGATGCAGCAGGAAGATGG + Intergenic
982720525 4:158855058-158855080 AAAGAGGAGTAGGAGAAGGAAGG + Intronic
982745948 4:159103867-159103889 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
982862003 4:160463944-160463966 AAAGAGAAGCAGCTGGACAATGG - Intergenic
983168769 4:164512206-164512228 AAAGAGGTGCAAGAGGAGGAAGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983307935 4:166017678-166017700 AAAGAGAAAGAACAAGAGGAAGG - Intronic
983381013 4:166993487-166993509 AAAGAGAAATAGCATGAGGGTGG - Intronic
983547498 4:168979102-168979124 AAGGAGGAGTAACAGGAGGAGGG - Intronic
983608887 4:169620561-169620583 GAAGAGAAGCGGCAGGAGTCAGG - Exonic
984218399 4:176943177-176943199 AAAGAGGAGAAAAAGGAGGAGGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985184694 4:187303347-187303369 TAAGGGAAGAAGCAGCAGGATGG - Intergenic
985250810 4:188022594-188022616 AAAGTTTAGCAGGAGGAGGAAGG + Intergenic
985342492 4:188970107-188970129 GAAGAGAAGCAGCAGCACAAAGG - Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985447993 4:190038161-190038183 ACAGGGAAGCGGCTGGAGGAAGG - Intergenic
985493057 5:190312-190334 AAAGAGAAACAGCAGTGGGAGGG - Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
986017551 5:3770916-3770938 AAACAGAAGCAGCTGGAAGTGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986879105 5:12147877-12147899 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987292358 5:16520858-16520880 AAAGAGGAGCAGGAGGTGGCAGG + Intronic
987518601 5:18948261-18948283 AAAGAGAAGAAGGAGAAGGAAGG + Intergenic
987566412 5:19593670-19593692 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
989119447 5:37989973-37989995 AAAGAAAGACAGCAGGAGAAGGG - Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989410138 5:41110847-41110869 AAAGAGGAGAAGGAAGAGGAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990526482 5:56633167-56633189 AAAAAGGAGGAGCAGGAGGAGGG + Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990569686 5:57065711-57065733 AAAGAAAAGGAGGAGGAGGGAGG - Intergenic
990635094 5:57716594-57716616 GAAGAGGAGAAGCAGGAGGAAGG + Intergenic
990719617 5:58679174-58679196 AAGGAGAAGCAGCAGGGTGGGGG + Intronic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992004465 5:72463706-72463728 AGAAAGGACCAGCAGGAGGATGG + Intronic
992018015 5:72595269-72595291 AAAGAGCAGCATCAGGGGAAAGG + Intergenic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992219572 5:74558346-74558368 GAAGAGGAAGAGCAGGAGGAGGG + Intergenic
992511245 5:77437721-77437743 GAAGAGAGGTAGCAAGAGGAGGG - Intronic
992605205 5:78448356-78448378 AAAGACAAGCAACAGACGGAGGG + Intronic
992714472 5:79496319-79496341 AAATAGGAGCACCAGGAGAAAGG + Intronic
993424206 5:87742074-87742096 AAAGTGAAGTAGCAGTGGGAGGG - Intergenic
993503292 5:88684994-88685016 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
993558473 5:89372615-89372637 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
993835301 5:92812476-92812498 AAAGAGGAGCAAAAGGAAGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994203819 5:97009680-97009702 AAATAGCAGCAGCAGCAGCAAGG - Intronic
994229115 5:97293426-97293448 AAAGTCAAAAAGCAGGAGGATGG - Intergenic
994275819 5:97836147-97836169 AAAGAAGAGGAGGAGGAGGAAGG - Intergenic
994301206 5:98150023-98150045 GAAGAGGAGGAGTAGGAGGAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994591727 5:101782668-101782690 AAAGGTAAGAAACAGGAGGAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995086359 5:108115247-108115269 AAAGAGAAACAGGAGAAGCATGG + Intronic
995132176 5:108642313-108642335 AAAGAGTGGAAGCAGGAGGCTGG - Intergenic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
995772096 5:115681905-115681927 GAAGGGAAGAAGCAGGAAGAAGG - Intergenic
996527508 5:124494317-124494339 AAAGAGAAGAAGCAGAAAGATGG + Intergenic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
996912750 5:128674166-128674188 ATAAAGAAACAGCAGGAGGCGGG - Intronic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
996975200 5:129424384-129424406 AAAGAGAGGCAATAGGAAGATGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998597683 5:143550767-143550789 AAAAAGAAGGAGGAAGAGGAGGG - Intergenic
998648287 5:144089066-144089088 GAAGAGAATGAGCAGGAAGAAGG - Intergenic
998658309 5:144206688-144206710 AAATAGCAGCAGCAGAAGAAAGG + Exonic
998765100 5:145477838-145477860 AAAGAGAAGGAGGAGGAGAAAGG + Intronic
998977003 5:147659331-147659353 ACAGAGAACCAGCAGAAGCAGGG - Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999174421 5:149621850-149621872 GAAGAGAAGCTGCTGGAGGTGGG + Exonic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999872319 5:155765382-155765404 AAAGAGAAGGAGGGGAAGGAGGG + Intergenic
1000111991 5:158117054-158117076 AAAGAGAAAGAGGAAGAGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000440779 5:161260582-161260604 AAAGATAAGAAGTAAGAGGAAGG + Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1000882310 5:166712425-166712447 AAAAAGAAGCACCAGGTGGGAGG - Intergenic
1000895047 5:166845343-166845365 AAAGAGAGACAGCAGGTTGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001079730 5:168658865-168658887 AAAGTTAAGCAGCAGGATGCAGG + Intergenic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001763686 5:174227845-174227867 AAAGAGACCCTGCCGGAGGAAGG + Intronic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002600320 5:180350821-180350843 TGAGAGAAGCAGCAGGATAAAGG + Intronic
1002679120 5:180947696-180947718 GAAGAGAAGCAGCTGGATGTGGG - Intronic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003064881 6:2895333-2895355 GAAGAGCCGCAGGAGGAGGACGG + Intronic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003393219 6:5731270-5731292 GAAGAGAAGGAGGAAGAGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003577711 6:7313085-7313107 TAAGAGAAGCAGCAGCAAGCGGG + Exonic
1003607580 6:7577921-7577943 AAAGGGAAGAAGCAGAAGGAGGG - Intronic
1004086741 6:12457086-12457108 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1004257992 6:14082638-14082660 AAACAGAAGCTGCAGGTGAATGG + Intergenic
1004280679 6:14276998-14277020 AAAGATGAGCAGGAGGAGAAGGG - Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1004590471 6:17046827-17046849 AAAATGAAGCTACAGGAGGAAGG - Intergenic
1004636105 6:17469257-17469279 GAAGAGAAGCACCCGGAGGGTGG + Intronic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005369922 6:25121791-25121813 AAAGAGAAAAGGAAGGAGGAAGG + Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005665046 6:28044169-28044191 AAAGAAAGGAAGCAGGAGGGAGG + Intergenic
1005695798 6:28351622-28351644 AAAGGGAAGGAGGAGGAGAAGGG - Intronic
1005761719 6:28973677-28973699 AAAGAGGAGAAGGAAGAGGAGGG - Intergenic
1005803092 6:29446525-29446547 GCAGAGAAGCAGCAGGAGTCAGG + Intronic
1005951370 6:30633808-30633830 AAAGAGGAGAAGGAAGAGGAAGG + Intronic
1005987372 6:30883536-30883558 GAAGAGGAGCAGGAGAAGGATGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006445623 6:34078258-34078280 ACAGAGAAGAAGCAGAAGGTGGG - Intronic
1006599069 6:35213901-35213923 AAAGAGGAGGAGGAGGAGAAAGG + Intergenic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007335387 6:41151645-41151667 GAAGAAATGCAGCAGGAAGATGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007410514 6:41658684-41658706 AAGGTGAAGCAGCAGGCTGAAGG + Intergenic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007578229 6:42939515-42939537 GAAGAGGAGCAGCAGGAGAGAGG - Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1007824755 6:44592121-44592143 AAAGAGAGGCAGGAGAAGGCAGG + Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008256034 6:49301168-49301190 AAAGATAAACAACATGAGGAAGG - Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009321660 6:62298070-62298092 AAATAGAAGCAGGAGGATCAAGG + Intergenic
1009593666 6:65708583-65708605 GAAGGGAAGGAGGAGGAGGAAGG - Intergenic
1009993825 6:70877343-70877365 AAAGAGAAGGAGCAGGATTGGGG + Intronic
1010232218 6:73545113-73545135 TAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1010388929 6:75313990-75314012 AAAGAGAAATAACAAGAGGAAGG - Exonic
1010795936 6:80116264-80116286 AAAGACAAACTGCAGGAGGGGGG - Intronic
1011059062 6:83242450-83242472 AACTAGAAGTAGCAGGGGGATGG + Intronic
1011083683 6:83515803-83515825 AAAGAGAAGTAGTAGTAGTAGGG - Intronic
1011361628 6:86531700-86531722 AAAGAGAAGGAGGAGGAGAGAGG - Intergenic
1011484802 6:87830171-87830193 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011749274 6:90438947-90438969 AAAAAAAAGAAGCAGGATGAGGG - Intergenic
1012118296 6:95332930-95332952 AAAGAGAAGGAGTAAGATGAGGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1012649833 6:101738927-101738949 TAAGAGTGGCAGCAGGAGCAAGG + Intronic
1012873718 6:104700674-104700696 AAAGAGAAAAAGCAGGATGAGGG + Intergenic
1012980998 6:105830870-105830892 AAAGGGAGGCAGCTGGAGGAGGG + Intergenic
1013312084 6:108904656-108904678 AAAAAGAAGAAGAAGAAGGAAGG + Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013348133 6:109282072-109282094 AAAGAGGAGAAGCAGGGAGAAGG - Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1013673652 6:112433248-112433270 AGAGAGAAGAAGCATGAGCAAGG + Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014207566 6:118672779-118672801 AGAAAGAAGAAGGAGGAGGAAGG + Intronic
1014262289 6:119232816-119232838 AAAGAGAAGAGGCAGGAGTCAGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015311120 6:131768192-131768214 AGAGAACAGCACCAGGAGGATGG - Intergenic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015521885 6:134139899-134139921 GAAGAGAAGGAGGAAGAGGAAGG - Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015804238 6:137092365-137092387 GGAGAGAAACAGGAGGAGGAAGG - Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016341938 6:143071740-143071762 GAAGAGAAGAAGGAGGAAGAGGG - Intronic
1016563483 6:145424260-145424282 ATAGAGAAACAGCTGGATGAGGG + Intergenic
1016694479 6:146976755-146976777 AAAGAGAAGAAGAAGGATGGGGG - Intergenic
1016833689 6:148456218-148456240 AAAGTGAGGCAGCAGGGGGCTGG - Intronic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017297216 6:152811983-152812005 AAAGAGAAAGAAGAGGAGGAAGG - Intergenic
1017326694 6:153149230-153149252 CAAGAGAGGAAGCAGGAGGTAGG + Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339618 6:153305375-153305397 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017567097 6:155699258-155699280 AAAGAGAAAAAGAAGAAGGAAGG - Intergenic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1017941352 6:159055890-159055912 AAAGGGAAGGGGCAGGAGGGTGG + Intergenic
1018581130 6:165309245-165309267 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019865849 7:3709371-3709393 AAGTAGGAGCAGCAGAAGGAAGG - Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011383 7:4807632-4807654 AGAGAGAAGGAGCGGGAGGAGGG - Intronic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020410710 7:7888864-7888886 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1020571623 7:9870774-9870796 GGAGAGAAGCATCAGGAGAAAGG + Intergenic
1020861460 7:13496940-13496962 AATGAGCAGCAGCAGCAGAAAGG + Intergenic
1021163516 7:17305112-17305134 ATAGGGCAGCAGCAGGAGGGTGG + Intronic
1021480116 7:21106454-21106476 AAAGAGAACCCGGGGGAGGAAGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021789886 7:24194275-24194297 TAAGAGAAGGAGCAAGAGGGAGG + Intergenic
1021904279 7:25317682-25317704 AAAAAGGAGCAGTTGGAGGAAGG + Intergenic
1022036148 7:26536842-26536864 CAAGAGAAGCAGCAGTTGGCAGG + Exonic
1022144185 7:27521064-27521086 AAATAGAAGCCCCAGCAGGATGG + Intergenic
1022151126 7:27607708-27607730 TTAGATAAGCAGCTGGAGGAAGG - Intronic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1022850562 7:34257324-34257346 AAAGAGAAGCCACAGGGGGTGGG - Intergenic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1022964920 7:35463874-35463896 AAAGAGAAGCATCAGAAGCAGGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023616167 7:42022498-42022520 AAAGAGAGAGAGCAGGAGGAGGG + Intronic
1023654264 7:42403994-42404016 AAAGAGATACAGCAGCAGCAGGG - Intergenic
1024327139 7:48117725-48117747 AAAGAAAAGAATCAGGAAGATGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024581952 7:50807627-50807649 AATAAGATGCAGCAGGAGCACGG - Intergenic
1024674576 7:51626723-51626745 GAAGGGAAGCAGCAGCAGGAGGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024736782 7:52313677-52313699 AAAGAAAAGAAGGAGAAGGAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1025058040 7:55780956-55780978 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1025307401 7:57874619-57874641 AAAGAGGAGCATCAGGAAAATGG - Intergenic
1025951064 7:66145868-66145890 AAAGAGAGGAAGCAAGAGCAGGG - Intronic
1025994325 7:66518604-66518626 GGACAGAGGCAGCAGGAGGAGGG - Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1026985935 7:74555293-74555315 GGACAGAGGCAGCAGGAGGAGGG - Intronic
1027001496 7:74657694-74657716 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1027002871 7:74666492-74666514 AAAGAAAACGAACAGGAGGAAGG - Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027755818 7:82210792-82210814 AAAGGGAAACAACAGGAGAATGG - Intronic
1027780777 7:82517317-82517339 AAAGAGAGGAAGGTGGAGGAAGG + Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028466222 7:91155166-91155188 AGAGAGAAGGAACAGCAGGAAGG + Intronic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028715061 7:93956234-93956256 AAAGGGAAGCTGGAAGAGGAAGG + Intergenic
1028744245 7:94309440-94309462 AAAGATCAGTAGCTGGAGGAGGG - Intergenic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029167473 7:98603092-98603114 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029812111 7:103059775-103059797 AAAGATAGGTAGCAGGAGAAAGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030007776 7:105135434-105135456 AGAGAGCAGCAGCAGAGGGAAGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030324183 7:108202704-108202726 TAAGATAAGCACCAGGAGAATGG - Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030947366 7:115740349-115740371 TAAGAGAAGTACCTGGAGGATGG + Intergenic
1030956909 7:115864240-115864262 GAAGTACAGCAGCAGGAGGATGG - Intergenic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031991439 7:128201578-128201600 ACAGAGAAGCCGGCGGAGGAAGG - Intergenic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032466830 7:132151390-132151412 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032523393 7:132562467-132562489 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1032523660 7:132563594-132563616 GAAGAGAAGGAGGAGGAGAAAGG - Intronic
1032746946 7:134795606-134795628 AAAGAAAAGGAGGAGGGGGAAGG - Intronic
1032800514 7:135313970-135313992 ACAGAGAAGCAGCAGCAGTTGGG + Intergenic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1033023781 7:137753530-137753552 ACAGAGTGGGAGCAGGAGGAGGG + Intronic
1033204674 7:139408371-139408393 AAAAAGCAGCAGCATCAGGATGG + Intronic
1033432340 7:141300569-141300591 AAGGAGAAGAAGCAGAAGAAGGG - Intronic
1033500602 7:141945290-141945312 GCATAGAAGTAGCAGGAGGATGG + Intronic
1033519830 7:142149354-142149376 AAAGAGAAGAGGCCAGAGGATGG - Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033832579 7:145271426-145271448 AAGGTGGAGGAGCAGGAGGAGGG + Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1033890458 7:146006492-146006514 GAAGAGGAGCAGGAGGAGAAAGG - Intergenic
1034093004 7:148381561-148381583 GAAGAGAAGCAGCTGGACGTTGG - Intronic
1034096091 7:148409194-148409216 AAAGAGAAACAGCAGGAACAGGG + Intronic
1034096277 7:148410779-148410801 AAAGTTGAGCAGGAGGAGGAAGG + Intronic
1034166415 7:149028370-149028392 CAAGAGCAGCAGGAGCAGGAAGG + Exonic
1034319708 7:150168839-150168861 AAAGAAAATCAGCTGGGGGATGG + Intergenic
1034446608 7:151117007-151117029 AAAGCAAAGAAGCAGCAGGAGGG - Intronic
1034550085 7:151814923-151814945 AAAGACAGGCAGCAGGATGGAGG + Intronic
1034865084 7:154634703-154634725 AAAGAGAAGAAGGAAGAAGAAGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978911 7:155463438-155463460 AGAAAGGAGGAGCAGGAGGAAGG - Exonic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035117816 7:156539676-156539698 AGAGAGAAGCAGGGGGAGGGAGG - Intergenic
1035117835 7:156539753-156539775 AGAGAGAAGGAGGAGGAGGGAGG - Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035724209 8:1814420-1814442 AAAGAGAAGCAGCAGAGAGGAGG - Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036159222 8:6371027-6371049 AAAACGAAGCAGCAAGAGCAGGG + Intergenic
1036509521 8:9387506-9387528 AAAGTGAGGCCGCAGGTGGATGG + Intergenic
1036557136 8:9870094-9870116 AAAGTGAAGCACCAGGGGGCCGG + Intergenic
1036562390 8:9907688-9907710 AAAGAGGAAGAGGAGGAGGAGGG + Intergenic
1037041686 8:14244214-14244236 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
1037041690 8:14244236-14244258 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
1037134158 8:15442599-15442621 TAAGAGAAACATCAGGAGTAAGG - Intronic
1037218213 8:16484051-16484073 AAAGAGAAGGAGAAGAAGAAAGG + Intronic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037691233 8:21183258-21183280 GGAGAGAAGGAGGAGGAGGAAGG - Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037898398 8:22673551-22673573 AGAGAGAAGGAGGGGGAGGAGGG - Intergenic
1038039037 8:23708576-23708598 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038353059 8:26798483-26798505 AATGAGAATAAGCAGGAGGTAGG - Intronic
1038712373 8:29959389-29959411 AAAGAGAAGATGAAGGAAGAGGG + Intergenic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1039393545 8:37202787-37202809 AAAGAGACACTGCAGGAGGAAGG - Intergenic
1039436179 8:37560894-37560916 AGAGAGGAGAAGGAGGAGGAGGG - Intergenic
1039516685 8:38139756-38139778 AAATGTAAGCAGCACGAGGAAGG + Exonic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040079746 8:43274824-43274846 AATGAGAATGAGGAGGAGGAGGG - Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040079814 8:43275033-43275055 AGAGAGGGGAAGCAGGAGGAGGG - Intergenic
1040571459 8:48615129-48615151 AAAATGAAGCGGCAGAAGGAAGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041155794 8:54985478-54985500 AAAGAGAAGAGGGAGAAGGAGGG + Intergenic
1041165670 8:55090140-55090162 AAACAAAGGCAGCAGTAGGAGGG - Intergenic
1041214967 8:55591321-55591343 GAAGACAAGCAGGGGGAGGATGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041316313 8:56566494-56566516 TAAGAGAAGCAGGGGCAGGAGGG - Intergenic
1041360198 8:57044949-57044971 CAAGAGAAGAAGCAAGAGAAAGG - Intergenic
1041952543 8:63520079-63520101 AATAAGAAGAAGCAGAAGGATGG + Intergenic
1042207676 8:66345427-66345449 AGAGAGAGGCAACAAGAGGAAGG + Intergenic
1042462252 8:69083265-69083287 AAAGTGGAGGAGCAGGAGCAGGG - Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042701876 8:71624540-71624562 TCAGAGAAGCTGTAGGAGGAAGG - Intergenic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042917999 8:73894134-73894156 AAAGAGAAGAAGCAGCTGGGAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043832924 8:85011946-85011968 AAAGAGAAGAAAAGGGAGGAGGG - Intergenic
1044274680 8:90285838-90285860 AAGGAGAAGCAGCTGGATGTTGG - Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1044917776 8:97134345-97134367 AAAAAGAAGCAGCAGCATGAAGG + Intronic
1044972143 8:97630112-97630134 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045324348 8:101106602-101106624 AGAGTGAAGCAGCAGGATGAAGG + Intergenic
1045632033 8:104135660-104135682 ACAGAGAAGCAGCATGTGGTAGG + Intronic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046061441 8:109144664-109144686 AAAGGGAAGGAGCAGGGGGTGGG - Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046332272 8:112734225-112734247 AAAGAGAAAGAAGAGGAGGAAGG + Intronic
1046447908 8:114347316-114347338 AAAGAAAAGCAGCAGCAAGAGGG - Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047209533 8:122830309-122830331 AAATAGCAGAAGCAGGAAGAAGG - Intronic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047511610 8:125520253-125520275 TAAGAGGAGCCACAGGAGGAAGG + Intergenic
1047526415 8:125638086-125638108 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047958990 8:129997119-129997141 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1048383741 8:133892100-133892122 AAACAAAATCAGCAAGAGGATGG - Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048889422 8:138934437-138934459 AAAAAGAAGGAAGAGGAGGAAGG + Intergenic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049402618 8:142436333-142436355 AAAGGGGAGCAGGAGGAGGGTGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050058515 9:1680411-1680433 AAAGAGAAGCCTCAGAAGGGAGG + Intergenic
1050358544 9:4805384-4805406 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1050418119 9:5435459-5435481 AGAGTGAAGCTGGAGGAGGATGG - Intronic
1050575831 9:6994311-6994333 GAAGAAAAGCAGCAGGGGGAGGG - Intronic
1050744238 9:8858093-8858115 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1050815832 9:9810054-9810076 GAAGAGGAGGTGCAGGAGGAAGG - Intronic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1052092989 9:24352811-24352833 AAAGAGAAGGAGCAAGCTGAGGG - Intergenic
1052196924 9:25728364-25728386 AAATAGAAGCAGCATGAAGCAGG - Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052736388 9:32346721-32346743 AAAGAGAAGAAGCAGAAGAGAGG - Intergenic
1052799943 9:32957634-32957656 GAAGAAAAACAGCTGGAGGAGGG + Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1052976794 9:34417063-34417085 AAAAAGAAGAAGAAGGAGAAGGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053138765 9:35668716-35668738 AAAGATAAGTAGCAGGATAAGGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053218930 9:36295262-36295284 AAAGAAAAGCAGCTGGAGGCTGG + Intronic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1054991409 9:71331661-71331683 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1055040090 9:71860748-71860770 AAATAAAAGTAGCTGGAGGAGGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055074237 9:72197286-72197308 ATAGAGAGGCAGCAGGGAGAGGG - Intronic
1055207846 9:73754067-73754089 ATAGTGTAGAAGCAGGAGGAGGG - Intergenic
1055369336 9:75580451-75580473 AAATAGAGACATCAGGAGGATGG - Intergenic
1055652025 9:78415499-78415521 AAATAGAATCATGAGGAGGATGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1055942020 9:81659523-81659545 AAATGTAAGCAGCAGGATGAAGG + Intronic
1056040517 9:82660698-82660720 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056236970 9:84604361-84604383 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
1056240102 9:84636740-84636762 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1056546840 9:87620548-87620570 GAAGAGAAGGAGTAGGGGGAGGG + Intronic
1056662107 9:88551649-88551671 AGAGAGAAGCAACAGGGGAAGGG - Intronic
1056802994 9:89707054-89707076 AAAGAGGAGAAGCAGGAGGGTGG - Intergenic
1056821989 9:89848948-89848970 AGAAAGCTGCAGCAGGAGGAAGG - Intergenic
1056862526 9:90199314-90199336 AAAGAGAAACATCAGCAAGATGG - Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057134499 9:92677919-92677941 AAAGAGAGGCAGGTGGAGGGTGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057544388 9:96006538-96006560 AAAAAGTAGCAGCAGCTGGAGGG + Intronic
1057556950 9:96095546-96095568 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058379946 9:104366597-104366619 AAAGAGCAGCAAGGGGAGGAGGG + Intergenic
1058444577 9:105043431-105043453 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1059065009 9:111074597-111074619 CAAGAGCAGCACCAAGAGGATGG + Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059228512 9:112695747-112695769 GAAGAGGAGGAGTAGGAGGAAGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059396249 9:114035776-114035798 ACAGAGAAGCAGGAGGAAGTGGG - Intronic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059883103 9:118714404-118714426 AAAGAAAAGCAAAAGAAGGAAGG - Intergenic
1060044471 9:120328811-120328833 AAAGGGAAGGGGCAGGAGGTAGG - Intergenic
1060501113 9:124156580-124156602 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1060762657 9:126268996-126269018 AAACAGACGCAGTAGGAGAAAGG - Intergenic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1061153927 9:128845760-128845782 AAAGAAGAGGAGCAGGAGGTGGG + Intronic
1061579116 9:131526045-131526067 AAACAGATGCAACAGCAGGAGGG + Intronic
1061632470 9:131881783-131881805 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062165389 9:135105007-135105029 GAGGAGAAGCAGCAGAAGAAAGG - Intronic
1062342222 9:136098831-136098853 AAAGGGAAGTAGCAGGCGGGGGG + Intergenic
1062530475 9:136997325-136997347 AAAAAGAAGCAGCAGGAGAGGGG + Intergenic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203636725 Un_KI270750v1:119668-119690 AAAAACAAGCAGCTTGAGGATGG - Intergenic
1185499285 X:584896-584918 AAAGAGGAGGAGGGGGAGGAGGG + Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185523727 X:761079-761101 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185661959 X:1735285-1735307 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185681765 X:1894183-1894205 AGAGAGAAGCAGTAGGAGAGGGG - Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1186027814 X:5333110-5333132 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186093556 X:6075706-6075728 CAAGAGAAGAAGCAAGAGAATGG - Intronic
1186124716 X:6400918-6400940 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1186393991 X:9189457-9189479 TGAGAGCAGCAGCTGGAGGAGGG - Intergenic
1186393997 X:9189504-9189526 TAAGAGCAGCAGCTGGAGGAAGG - Intergenic
1186672517 X:11781663-11781685 GAAGAGAGGGAGGAGGAGGATGG + Intergenic
1186788036 X:12971588-12971610 GAAGAGAAGAAGGAAGAGGAGGG - Intergenic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025805 X:15434227-15434249 AGATAGAAGAAGGAGGAGGAAGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187299451 X:18033585-18033607 AAAGAGAAGCAGCAGGCTTTGGG + Intergenic
1188150409 X:26667379-26667401 AAAGAGGAGGAGGAGGAAGAGGG - Intergenic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189596319 X:42570026-42570048 AAAAAGAAGCTGGAGGAAGAGGG + Intergenic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190072879 X:47293264-47293286 AGAGAGAAGAAGGAGGAAGAAGG + Intergenic
1190128432 X:47725294-47725316 AAAGAGATCCAACAGAAGGAGGG - Intergenic
1190220790 X:48511221-48511243 AAAGAGAGGGAGTGGGAGGAAGG - Intronic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1191104202 X:56762334-56762356 AGAGAGGAGGAGGAGGAGGAGGG - Intergenic
1191108385 X:56786625-56786647 AAAAAGAAGAAGCAGAAAGAAGG - Intergenic
1191190476 X:57661273-57661295 AAATGGAAGCAACAGCAGGAAGG - Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1192007469 X:67232661-67232683 GAAGAGGAGAAGGAGGAGGATGG - Intergenic
1192105990 X:68317460-68317482 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1192157398 X:68756880-68756902 AGAGAGAAGCAGCAGGGAGATGG + Intergenic
1192208189 X:69109943-69109965 GAAGAGAAGGAGGAGCAGGAAGG + Intergenic
1193212296 X:78821582-78821604 AAATAGAAGCAGCCTGAGGTGGG + Intergenic
1193483822 X:82060655-82060677 GAAGAGAAGCAGCAGCAGCATGG - Intergenic
1194267368 X:91771465-91771487 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
1194331228 X:92585177-92585199 AAAGAACAGCATCAAGAGGATGG + Intronic
1194369789 X:93058625-93058647 AAAGAAAAGCAGCAAGAGTCTGG + Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195263357 X:103155962-103155984 GAAGAGGAGGAGCAAGAGGAGGG - Intergenic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1196344754 X:114641176-114641198 AACAAGGAGAAGCAGGAGGATGG - Intronic
1196466376 X:115975196-115975218 AAAGTGAAAAAGCAGGGGGATGG + Intergenic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1197033674 X:121849250-121849272 GAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1197705050 X:129628921-129628943 AGAGAGCAGGAGTAGGAGGATGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198002463 X:132453034-132453056 AAAGGGAAGCAGCATGAATAAGG + Intronic
1198082915 X:133255828-133255850 ACAGAGCAAAAGCAGGAGGAGGG - Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198557801 X:137814308-137814330 AAATAGAACCAGCAGGATGAAGG + Intergenic
1198576521 X:138016156-138016178 GAAGAGGAGGAGGAGGAGGATGG - Intergenic
1198613250 X:138425358-138425380 AGAGAGAAGCAGCTGGACGTTGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199059713 X:143340553-143340575 AAAGAGAAAGAAGAGGAGGAGGG + Intergenic
1199185762 X:144913038-144913060 AAACAGAAGCAACAGCAGGAAGG + Intergenic
1199780346 X:151052427-151052449 AGAGAGAGGAAGCAGGTGGAAGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200584573 Y:4992402-4992424 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
1200677978 Y:6174835-6174857 AAAGAAAAGCAGCAAGAGTCTGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201300227 Y:12498706-12498728 AAAGAGGAGAAGGAGGGGGAAGG - Intergenic
1201453001 Y:14136300-14136322 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201474280 Y:14364074-14364096 AAAGAGAAGGAGGAGAAGAAAGG + Intergenic
1201504633 Y:14684509-14684531 CAAGAGAAGAAGCAAGAGAATGG + Intronic
1201540123 Y:15096840-15096862 AGAGAGAAGGACCAGAAGGAAGG - Intergenic
1201625595 Y:16011691-16011713 GAAGAAAAGAAACAGGAGGAAGG + Intergenic
1201671844 Y:16530635-16530657 AAAGAAAAGAAGCAGTAGGCTGG + Intergenic
1201739707 Y:17310945-17310967 GAAGAGAAGGAGGAGGAGAAGGG - Intergenic