ID: 1057389092

View in Genome Browser
Species Human (GRCh38)
Location 9:94628012-94628034
Sequence CTGATCATGCAGGGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057389078_1057389092 23 Left 1057389078 9:94627966-94627988 CCTCAGCCCCACTGCCAGAAAAG 0: 1
1: 0
2: 2
3: 63
4: 394
Right 1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG No data
1057389083_1057389092 9 Left 1057389083 9:94627980-94628002 CCAGAAAAGGAGTCAACAGTAGC 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG No data
1057389080_1057389092 17 Left 1057389080 9:94627972-94627994 CCCCACTGCCAGAAAAGGAGTCA 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG No data
1057389076_1057389092 25 Left 1057389076 9:94627964-94627986 CCCCTCAGCCCCACTGCCAGAAA 0: 1
1: 0
2: 3
3: 27
4: 344
Right 1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG No data
1057389082_1057389092 15 Left 1057389082 9:94627974-94627996 CCACTGCCAGAAAAGGAGTCAAC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG No data
1057389081_1057389092 16 Left 1057389081 9:94627973-94627995 CCCACTGCCAGAAAAGGAGTCAA 0: 1
1: 0
2: 1
3: 16
4: 192
Right 1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG No data
1057389077_1057389092 24 Left 1057389077 9:94627965-94627987 CCCTCAGCCCCACTGCCAGAAAA 0: 1
1: 0
2: 1
3: 27
4: 306
Right 1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057389092 Original CRISPR CTGATCATGCAGGGGCAGGA AGG Intronic
No off target data available for this crispr