ID: 1057390776

View in Genome Browser
Species Human (GRCh38)
Location 9:94639921-94639943
Sequence TCTGCAGCTCCTGCCCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 325}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057390774_1057390776 -3 Left 1057390774 9:94639901-94639923 CCACATGGCCTGGCTTTAGCTCT 0: 1
1: 0
2: 6
3: 19
4: 266
Right 1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 325
1057390768_1057390776 26 Left 1057390768 9:94639872-94639894 CCAGCTAGGCAGCGAAACCCGCA 0: 1
1: 0
2: 1
3: 10
4: 52
Right 1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 325
1057390770_1057390776 9 Left 1057390770 9:94639889-94639911 CCCGCAGCCAGTCCACATGGCCT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 325
1057390771_1057390776 8 Left 1057390771 9:94639890-94639912 CCGCAGCCAGTCCACATGGCCTG 0: 1
1: 0
2: 3
3: 40
4: 343
Right 1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 325
1057390773_1057390776 2 Left 1057390773 9:94639896-94639918 CCAGTCCACATGGCCTGGCTTTA 0: 1
1: 0
2: 0
3: 18
4: 227
Right 1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 325
1057390767_1057390776 29 Left 1057390767 9:94639869-94639891 CCACCAGCTAGGCAGCGAAACCC 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057390776 Original CRISPR TCTGCAGCTCCTGCCCCGTG TGG Intronic
900077583 1:830236-830258 TTTTCACCTCCTGCCGCGTGAGG + Intergenic
900115640 1:1026698-1026720 TCTGCAGCCCCAGCCCCGCTGGG - Intronic
900165055 1:1241229-1241251 TCTGCAGCCCCTGCCCTGCTTGG - Intergenic
900385484 1:2408697-2408719 CCTGCAGCTCCTGCTCCAGGGGG + Exonic
900521060 1:3105799-3105821 TGTGCAGCCCCTTCCCCCTGCGG + Intronic
900597909 1:3490804-3490826 GGTGCAGCTGCTGCCCTGTGGGG + Intronic
900644039 1:3700930-3700952 CCTCCAGCTCCTGGCCGGTGAGG + Intronic
900688422 1:3964488-3964510 TCTGCAGCAGCTGCACGGTGGGG - Intergenic
900818686 1:4869856-4869878 CCTGCAGCTCCTGCACCATCAGG - Intergenic
902412287 1:16218440-16218462 GCTGCAGCTCCTGCCCGATCTGG + Intergenic
903500733 1:23798938-23798960 CCAGCAGCTCCAGCACCGTGTGG + Exonic
904841132 1:33372668-33372690 TCTGCAGCTCCTCCCCAGCACGG + Intronic
906036374 1:42752548-42752570 TCTGCAGCTCCTGACACTCGTGG + Exonic
906158068 1:43625787-43625809 TCTGCAGGACCTGGCCTGTGTGG + Intergenic
907564888 1:55425508-55425530 TCTGGAGCTCCTGCCACATGGGG + Intergenic
910746896 1:90583862-90583884 TCTGGTGCTCCTACCCCATGGGG + Intergenic
914323296 1:146586156-146586178 TCTTCAGCTCCTGACCACTGAGG + Intergenic
914878620 1:151530605-151530627 TCTGCTGCTCCTGCCCCAGGCGG - Exonic
915815612 1:158962213-158962235 TCAGGAGGTCCTGCCCAGTGAGG - Intronic
921082998 1:211758481-211758503 TCTCCATCTCCTGACCCCTGTGG - Intronic
921877797 1:220218830-220218852 TATACAGCTGCTCCCCCGTGTGG - Intronic
922507026 1:226132583-226132605 ACTGCAACTCCTGCCTCCTGGGG - Intergenic
923071401 1:230568176-230568198 GCTGCAGCTCCTGCTGCCTGTGG + Intergenic
923274919 1:232387320-232387342 TCTGCAGCCCCTGCCCTGCCGGG - Intergenic
923833719 1:237586435-237586457 TCTGTAACTCCTGCCCCTTAGGG - Intronic
923879806 1:238091336-238091358 TCTGCAGCTCCTCCGTAGTGGGG + Intergenic
924941387 1:248814466-248814488 TCAGCATCTCCTGCCACGTGGGG + Exonic
1062906732 10:1184634-1184656 TCTGCAGCTCCAGCCTGGTCTGG + Intronic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1063520598 10:6737345-6737367 TTTGCAGTTCCTCCCCTGTGGGG + Intergenic
1063977488 10:11429033-11429055 TCTGCAGCTCTCGCCTTGTGGGG + Intergenic
1066613607 10:37275549-37275571 TCTGCAGCTGCTGGCCCAGGTGG + Intronic
1066758826 10:38736466-38736488 TCTGCTTCTCCTGCTCCCTGAGG + Intergenic
1068900931 10:62268668-62268690 TCTGCGGCTCCTGCCAGGGGCGG - Exonic
1069146290 10:64896029-64896051 TCTGCAGCACCTGCCCAGCCTGG - Intergenic
1070678616 10:78433319-78433341 TCTCCAGCTCCAGCTCAGTGGGG + Intergenic
1072637593 10:97187624-97187646 TCACCAGCTCCTGCTCCATGGGG + Intronic
1073249775 10:102114499-102114521 TCAGCAGCTCATGTCCCGAGTGG + Intronic
1075880756 10:125848722-125848744 TCTGCAGCTCAGGGCCCCTGTGG + Intronic
1076508723 10:130997429-130997451 TCTACAGCTCTTGCCCTGGGAGG - Intergenic
1076638648 10:131899829-131899851 TTGACAGCTCCTGCCACGTGCGG - Intergenic
1077047333 11:552341-552363 CCTGCATGTCCTGTCCCGTGGGG + Intronic
1077434948 11:2534472-2534494 TCTGCAGCTGCCGCCCGCTGAGG + Intronic
1077452424 11:2656483-2656505 TCAGGAGCTCATGGCCCGTGGGG - Intronic
1077476561 11:2793059-2793081 TCAGCAGCTCCTGCCCTGACGGG - Intronic
1077771797 11:5226972-5226994 TCTGCCGTTACTGCCCTGTGGGG - Exonic
1078094461 11:8288198-8288220 TCTGTAGTTCCTGCCCAGAGGGG - Intergenic
1083376778 11:62229943-62229965 TCTGCATCATCTCCCCCGTGAGG - Intergenic
1083595880 11:63918072-63918094 GCTGCAGCACGTGCCCCGGGCGG - Intergenic
1084317703 11:68354920-68354942 CCTGCTCCTCCGGCCCCGTGGGG - Intronic
1085045576 11:73351076-73351098 GCTGCTGCTCCTGCTCCTTGTGG + Intronic
1085880607 11:80463132-80463154 TTTGGAGGTCCTGCCCAGTGGGG - Intergenic
1087225358 11:95592677-95592699 ACTGGAGCTGCTGTCCCGTGGGG + Intergenic
1089780058 11:120867400-120867422 GCTGCAGCTCCAGCCTCATGGGG + Intronic
1090204737 11:124878019-124878041 TCTGCAGCTCCTCCCCCGCTGGG - Exonic
1090862770 11:130669190-130669212 TCTGCAGCTTCTGCCACATCTGG - Intergenic
1091180063 11:133596291-133596313 TCTGCAGCTCCTGCTCAGAGTGG - Intergenic
1091219610 11:133922315-133922337 TGAGCAGCTCCTTCCCTGTGCGG - Intronic
1093383590 12:18523744-18523766 TCTGCAGTTCCTCCCCAGTATGG + Intronic
1095570085 12:43674973-43674995 GCTGCAGCTCCTGCCATCTGTGG + Intergenic
1097344743 12:58478260-58478282 TATTCAGCTCCTGCCATGTGGGG + Intergenic
1098585233 12:72146582-72146604 TCTGCAGCTCAAACCCCTTGAGG + Intronic
1102217531 12:111171771-111171793 TCTCCGGCTCCTTCCCCGGGAGG - Intronic
1102868933 12:116397498-116397520 ACTGCAGCCCCTGCCTCTTGGGG + Intergenic
1102952208 12:117038378-117038400 GAAGCAGCTCCTGCCCTGTGTGG - Intergenic
1103930626 12:124449003-124449025 GCTGCAGATCTTGCCCCTTGAGG - Intronic
1104774970 12:131385663-131385685 TCAGCAGCTGCTGCCAGGTGAGG - Intergenic
1104885924 12:132108229-132108251 TCTGCAGCCCCTGCCGTGAGGGG + Intronic
1105504578 13:20998804-20998826 GCTGCGGCCCCCGCCCCGTGTGG - Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1107111454 13:36702300-36702322 TCTGCAGCTGCTGACACTTGCGG - Intergenic
1108800829 13:54092704-54092726 TCAGGAGGTCCTGCCCAGTGAGG + Intergenic
1112494249 13:99893258-99893280 ACTGCTGCTGCTGCCCCGTCTGG - Exonic
1112968691 13:105232102-105232124 CCTGCAGTTGCTGCACCGTGCGG - Intergenic
1113226911 13:108169149-108169171 TCTGGAGGACCTGCCCAGTGAGG - Intergenic
1114533071 14:23407386-23407408 TCTGCTTCTCCTGCCCTCTGAGG + Intronic
1114536157 14:23424259-23424281 TCTGAAGCTCTTGCCAAGTGGGG - Intronic
1116932317 14:50702627-50702649 TCTGGTGATCCTGCCCAGTGAGG + Intergenic
1119031436 14:71195918-71195940 TCTGCAGCACCTTCCTCCTGTGG + Intergenic
1119852721 14:77877510-77877532 TCCACAGCTCCTGCCCACTGAGG - Intronic
1121896767 14:97655969-97655991 TCTGCAGCTGCTGTCAGGTGAGG - Intergenic
1122402593 14:101476158-101476180 TCTGCAGTTCCAGCCTCCTGAGG - Intergenic
1122436984 14:101706991-101707013 TCTGCAGCCCCTGCCCCTGTGGG - Intergenic
1123015441 14:105371692-105371714 TGTGCATCTCCTGCCCCCTGAGG - Intronic
1123065719 14:105618239-105618261 CCTGCAGCTCCTGCCCCTGCAGG - Intergenic
1123089117 14:105734272-105734294 CCTGCAGCTCCTGCCCCTGCAGG - Intergenic
1123094904 14:105762429-105762451 CCTGCAGCTCCTGCCCCTGCAGG - Intergenic
1123468892 15:20535644-20535666 TCTGCAGCTCCTTACCCAGGTGG + Exonic
1123649164 15:22465046-22465068 TCTGCAGCTCCTTACCCAGGTGG - Exonic
1123729167 15:23130627-23130649 TCTGCAGCTCCTTACCCAGGTGG + Exonic
1123747335 15:23328113-23328135 TCTGCAGCTCCTTACCCAGGTGG + Intergenic
1124199071 15:27660888-27660910 TCAGCAGCTGCTGCCCTTTGAGG - Intergenic
1124279696 15:28351966-28351988 TCTGCAGCTCCTTACCCAGGTGG + Intergenic
1124303002 15:28559642-28559664 TCTGCAGCTCCTTACCCAGGTGG - Intergenic
1124886796 15:33694743-33694765 TCTGCAGTCCCTGCCTAGTGAGG + Intronic
1125725440 15:41866103-41866125 CCTCCAGCTCCTGGCCCCTGAGG + Exonic
1125735759 15:41924451-41924473 TCTGCAGCTCCTGAGGCCTGTGG - Intronic
1126225338 15:46262749-46262771 TTTGGAGGTCCTGCCCTGTGAGG + Intergenic
1126900579 15:53310287-53310309 TGTGCAGCTCCCGCCCACTGTGG - Intergenic
1127426637 15:58864971-58864993 ACGGCAGCGCCTGCCCCGCGTGG - Intergenic
1128931988 15:71713435-71713457 TCAGCAGCTGTTGCCCCTTGGGG + Intronic
1129273013 15:74429266-74429288 ACTCCAGCTACTGCCCCCTGAGG + Intronic
1129407209 15:75327680-75327702 GCTGCACCTCCAGCCCCTTGGGG + Intergenic
1129656719 15:77529545-77529567 TCTGCACATCGTGCCCGGTGTGG + Intergenic
1129880704 15:79004420-79004442 GCTGCAGCTGCTGCCCTGAGGGG - Intronic
1130224300 15:82045875-82045897 CCTGCAGCCACTGCCCGGTGCGG - Exonic
1131064806 15:89427469-89427491 TCTGCATCTCCAGCCCTGTGAGG - Intergenic
1131351037 15:91699914-91699936 TCTGGAACTCCTTTCCCGTGGGG + Intergenic
1133127116 16:3654310-3654332 CCTGCAGCACCAGCGCCGTGGGG - Intronic
1137382595 16:48012940-48012962 TCTGAAGCTCCTACTGCGTGGGG + Intergenic
1137548700 16:49421941-49421963 TCTGCTGCTGCTGGCCCATGTGG - Intergenic
1137581452 16:49635968-49635990 TCTGCAGCCCCTGGCCATTGGGG + Exonic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1142088373 16:88196787-88196809 TCTCCGGCTCCTGCTCTGTGTGG - Intergenic
1142410238 16:89912338-89912360 CCTGCAGCTGCAGCACCGTGGGG - Intronic
1142803904 17:2361761-2361783 GCTGCAGCTCCTGTACCTTGTGG - Exonic
1143206598 17:5144840-5144862 TCTGCAGCTACTTCCCAGTCTGG - Exonic
1143694825 17:8605666-8605688 ACTGCAGCCTCTGCCCCCTGGGG - Intronic
1144100368 17:11937450-11937472 GCTGCAGCTCCAGCACAGTGCGG - Exonic
1144496330 17:15748335-15748357 TCTGCAGCCTCTTCCCCGTGAGG - Intronic
1144605912 17:16665734-16665756 TCTGCAGCCTCTTCCCAGTGAGG - Intergenic
1144738735 17:17569379-17569401 TGTGCAGCTCCTCCCCTCTGAGG - Intronic
1144888950 17:18483073-18483095 TCTGCTGCTCCTGACCTGAGTGG - Intronic
1145018798 17:19414787-19414809 GCAGCAGCTCCTGCACCTTGGGG - Exonic
1145143258 17:20461223-20461245 TCTGCTGCTCCTGACCTGAGTGG + Intronic
1146594298 17:34156052-34156074 GCTGGAGTTCCTGCACCGTGTGG - Intronic
1146948659 17:36890961-36890983 TCTGCAGCTCCTGCACCAGATGG - Intergenic
1148475309 17:47924911-47924933 TCAGCTGCTGCTGCCCTGTGGGG - Exonic
1148882252 17:50738193-50738215 TCTGCAGGTACTGACCCTTGGGG + Intronic
1149873800 17:60209371-60209393 TCTGCAGCTACTTCCCAGTCTGG + Exonic
1150087581 17:62286631-62286653 TCTGCAGCTACTTCCCAGTCTGG + Intergenic
1150473504 17:65457409-65457431 TCTGCAGCTCCTTCCTGGGGTGG + Intergenic
1151657711 17:75503410-75503432 CCTGCAGCTCCTCCCAGGTGAGG + Exonic
1152044697 17:77928240-77928262 TCTGCAGAGCCTGCAGCGTGAGG + Intergenic
1152662756 17:81550598-81550620 TCTGCAGCTTCTGCAGCCTGTGG + Exonic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1154415859 18:14174881-14174903 TCTGCTGCTCCTGCTCCCCGAGG - Intergenic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1158543822 18:58379149-58379171 TCTGCAGAGCCTGCTCTGTGGGG - Intronic
1159772288 18:72560170-72560192 CCAGCTGCTCCTGCCCCTTGTGG + Intronic
1159948315 18:74459884-74459906 TCTGCAGCGCCAGCCCAGGGTGG + Intergenic
1160568436 18:79800668-79800690 TCAGCAGTTCCTTCCCCGGGCGG + Intergenic
1160892734 19:1387804-1387826 TCTGCAGCTCCTGGCCTGCGCGG + Exonic
1160906242 19:1452980-1453002 TCTTCAGCTCCTGCAGCGTCTGG - Exonic
1161101590 19:2424467-2424489 TTCGCAGCCCCAGCCCCGTGTGG - Intronic
1161194289 19:2977594-2977616 TCCGCAGCTTCCGCCCGGTGAGG + Exonic
1161355814 19:3819151-3819173 CCAGGAGCTCCTGCTCCGTGGGG + Exonic
1162893902 19:13753195-13753217 TATCCAGGTCCTGCCCCCTGAGG + Intronic
1163013533 19:14440308-14440330 CCTCCAGCTCCTGCTCCGAGGGG - Exonic
1163520754 19:17790281-17790303 GCTGCAGCACCTGCCCTGTCTGG + Intergenic
1163796691 19:19342091-19342113 TCTGCAGCCCTTGCACCCTGAGG - Intronic
1165388746 19:35526697-35526719 TCTGCAGCTCCTTCCCGGCCTGG + Exonic
1167247803 19:48384167-48384189 TCTGCAGCTCCTGCCCTCCCTGG - Intronic
1167503789 19:49861148-49861170 CCTGGAGCCCCTCCCCCGTGGGG + Intergenic
1167776967 19:51564787-51564809 TCTGCAGCTCATACCCCGCGTGG + Intergenic
1168309690 19:55454270-55454292 TCTGCAACTCCTGCCCCAGCTGG + Intronic
1168659887 19:58157439-58157461 TCCGCAGCTGCTGGCCCGGGTGG - Intergenic
925155698 2:1647710-1647732 TCTGCAGATCCGGGCCCTTGGGG - Intronic
926132343 2:10311700-10311722 CCTGTAGCTCCTTCCCCCTGTGG + Intronic
927153811 2:20210595-20210617 TCAGCTGTACCTGCCCCGTGTGG + Intronic
927209568 2:20630734-20630756 TCTGAAGCCCCTGTCCAGTGAGG - Intronic
927692722 2:25219636-25219658 TCTGCAGAGCCAGCCCCCTGGGG + Intergenic
929547118 2:42862965-42862987 CCTGCTGCTCCAGCCCCGAGAGG - Intergenic
930099694 2:47593612-47593634 TCTTCAGCTACTCCCCCATGTGG + Intergenic
931795074 2:65700797-65700819 CCTGCAGCGCTTGCCCCTTGAGG - Intergenic
932485542 2:72082208-72082230 TCTGCAGCCCCTCTCCCCTGAGG - Intergenic
933220638 2:79683738-79683760 CCTGCAGCTCCTGCAACTTGTGG - Intronic
934238030 2:90248262-90248284 TCTGCTTCTCCTGCTCCCTGAGG + Intergenic
934559407 2:95304867-95304889 TCTGTAGCTCCTGCCCAGCCAGG - Intronic
934623830 2:95832576-95832598 TCTCCAGTTCCTGCCCAGTGAGG - Intergenic
934623914 2:95832988-95833010 TCTTGAGGTCCTGCCCAGTGAGG - Intergenic
934624074 2:95833593-95833615 TCTCCACTTCCTGCCCAGTGTGG - Intergenic
934624291 2:95834542-95834564 TCTTGAGGTCCTGCCCAGTGAGG - Intergenic
934624441 2:95835191-95835213 TCTGGAGGTCCTGCCCAGTGAGG + Intergenic
934646221 2:96060647-96060669 CCTCCAGCTCCTGCACCGTGAGG + Intergenic
934809191 2:97266434-97266456 TCTGGAGGTCCTGCCCAGTGAGG - Intergenic
934809219 2:97266537-97266559 TCTGGAGGTCCTGCCCAGTGAGG - Intergenic
934809420 2:97267371-97267393 TCTTGAGGTCCTGCCCAGTGAGG + Intergenic
934809466 2:97267577-97267599 TCTTTAGGTCCTGCCCAGTGAGG + Intergenic
934809707 2:97268606-97268628 TCTTGAGGTCCTGCCCAGTGAGG + Intergenic
934809796 2:97269019-97269041 TCTCCGGTTCCTGCCCAGTGAGG + Intergenic
934809855 2:97269235-97269257 TCTTGAGGTCCTGCCCAGTGAGG + Intergenic
934827842 2:97438750-97438772 TCTTGAGGTCCTGCCCAGTGAGG - Intergenic
934827901 2:97438966-97438988 TCTCCGGTTCCTGCCCAGTGAGG - Intergenic
934827988 2:97439379-97439401 TCTTGAGGTCCTGCCCAGTGAGG - Intergenic
934828286 2:97490632-97490654 TCTGGAGGTCCTGCCCAGTGAGG + Intergenic
934828314 2:97490735-97490757 TCTGGAGGTCCTGCCCAGTGAGG + Intergenic
934839623 2:97616729-97616751 CCTCCAGCTCCCGCACCGTGAGG + Intergenic
936094694 2:109522817-109522839 TCAGCAGCACCTGCCCAGGGTGG + Intergenic
937064443 2:119006551-119006573 TCTGCAACTCCTGCCCACCGAGG - Intergenic
937220742 2:120342001-120342023 CCTGCAGCTCCTGCAAGGTGTGG - Intergenic
937982129 2:127622080-127622102 CCTGCAGCTCCAGCCAGGTGGGG - Exonic
939503980 2:143021592-143021614 TCTCTTGCTCCTGCCACGTGAGG - Intronic
940830881 2:158463934-158463956 TGCTCAGCTCCTGCCCCGAGGGG - Intronic
941384963 2:164841469-164841491 GCTGCAGCCCCCGCCCCGTGGGG + Intronic
942093146 2:172513536-172513558 TCCGCAGCTGGTGCCCTGTGTGG + Intergenic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
946310792 2:218881380-218881402 TCTGGAGTTCCTGCCCTGTTGGG + Intronic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
946692267 2:222318981-222319003 CCTGCACCTCCAGCCCCGCGTGG - Intergenic
948583584 2:239004446-239004468 TCTGCAGCTCCTGGCAGGTGCGG - Intergenic
948612134 2:239176470-239176492 TCTCCAGCTCCTGCTCCTGGCGG + Exonic
1168772858 20:427306-427328 TTGGCAGCTCCTGACCCCTGAGG + Exonic
1169171819 20:3471326-3471348 GCTGCTGCTGCTGCCCTGTGAGG + Exonic
1169317307 20:4603273-4603295 TCTGCAGATCCTGCTCCTTCTGG + Intergenic
1172215990 20:33236100-33236122 TCTCAGGCTCCTGCCCTGTGGGG + Intronic
1172969755 20:38864873-38864895 TCTGCAGCTCCAGCTCCAGGAGG - Intronic
1174027593 20:47591031-47591053 ACTGCAGCCTCTGCCCCCTGGGG - Intronic
1174445061 20:50585404-50585426 TCTGCAGCCCCAGGCCCCTGTGG - Intergenic
1174734291 20:52950487-52950509 TCTGCTGAGCCTGCCCCATGTGG - Intergenic
1175547446 20:59787658-59787680 TCTCCAGCTCCTGGCCAGAGGGG - Intronic
1175749329 20:61484418-61484440 GATGCAGCTCGTGCCCAGTGAGG - Intronic
1175815775 20:61882566-61882588 TCTGAAGCCCCTGGCCCGGGGGG + Intronic
1175880380 20:62254582-62254604 GCAGCTGCTGCTGCCCCGTGCGG + Intronic
1176045849 20:63092232-63092254 GCTGCAGCTCCTGGCTCCTGTGG + Intergenic
1176072887 20:63235994-63236016 TCTGGAGCTCCTGACCCCCGGGG - Exonic
1176232650 20:64040046-64040068 TCTGCATTGCCTGCTCCGTGGGG + Intronic
1179540440 21:42080000-42080022 TCTGCAACTCCTGCCGCTGGAGG + Intronic
1179915837 21:44477649-44477671 CCTGGAGCTCCTGCACCATGGGG + Intergenic
1180859365 22:19068543-19068565 TCAGCAGTTCCAGCCCCATGGGG + Intronic
1180953111 22:19729638-19729660 TCTGCAGCTCCTGCCCTTCAGGG - Intergenic
1180998998 22:19979264-19979286 TCTGCACCTCCTCCCCTTTGGGG - Intronic
1181034093 22:20161649-20161671 GCTGCAGCCCCTGCCCTGGGGGG + Intergenic
1181436822 22:22915953-22915975 CCTGCAGCTCCAGGCCCCTGTGG - Intergenic
1181437663 22:22919879-22919901 CCTGCAGCTCCAGGCCCCTGTGG - Intergenic
1181438311 22:22922934-22922956 CCTGCAGCTCCAGGCCCCTGTGG - Intergenic
1181550884 22:23638582-23638604 CCTGCAGCTCCAGGCCCCTGTGG + Intergenic
1181797402 22:25320107-25320129 CCTGCAGCTCCAGGCCCCTGTGG - Intergenic
1182288887 22:29264138-29264160 CCTGCTGCTCCTGCCCACTGTGG - Exonic
1182440750 22:30362502-30362524 CCTGGGGCTCCTGCCCTGTGTGG - Intronic
1182466451 22:30519857-30519879 GCTGCAGCTCCTGCCTCATCAGG - Intergenic
1182737571 22:32541867-32541889 TCTGCAGCTCGTGCGGTGTGTGG - Intronic
1183064738 22:35355137-35355159 TCTTCAGCTCCTGCCCTTTTGGG - Intergenic
1183324250 22:37182959-37182981 TCTTCTGCTCCTGCACTGTGTGG - Intronic
1184040670 22:41941367-41941389 TCTGCAGCTCCTGCTGCGGCGGG + Intronic
1184759400 22:46536451-46536473 TCTGCCGCTCGTGCCCCGCCGGG + Exonic
1184784675 22:46665916-46665938 CCAGCAGCTCCTTCCCCGGGCGG + Intronic
1184874484 22:47264830-47264852 TCTGCAGCTCCTCACTAGTGTGG - Intergenic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185300486 22:50077361-50077383 TCTGCACCCCCTGCCCTGCGGGG + Intronic
950111913 3:10424082-10424104 TCTGCAGCCCCAGCCGAGTGGGG - Intronic
950616140 3:14159785-14159807 TCTGCAGCTCTTGACCCGGCTGG - Exonic
950747185 3:15099798-15099820 TCTGCAGCTCTTGCTCCTAGAGG - Intergenic
953534258 3:43765331-43765353 CCTGCATCCCCTGCCCCATGGGG - Intergenic
954388430 3:50256513-50256535 TCTGCTGCTCCTGCCTGATGTGG + Intronic
954670781 3:52290354-52290376 CCTGCAGGTCCTGCCCCGCTTGG + Exonic
954993125 3:54858188-54858210 TCTGCACCTCCTTCCCCTTGTGG + Intronic
955078938 3:55639973-55639995 CCTGGGGCTCCTGCCCTGTGTGG - Intronic
959333213 3:105033101-105033123 ACTGCAGCACCTACCCTGTGGGG + Intergenic
959462453 3:106643906-106643928 TCCGCAGCTGCTGGCCCGGGTGG - Intergenic
962254911 3:133864011-133864033 TCTGCAGCTCCTGGCCCTGGAGG - Intronic
963480618 3:145868544-145868566 TCTGTAGCTCCTGCTCCCTCAGG - Intergenic
964138363 3:153369980-153370002 TCTGCAGCTGCTGTCCTGGGTGG + Intergenic
965317690 3:167211753-167211775 TTTGGAGGTCCTGCCCAGTGAGG - Intergenic
966108210 3:176362447-176362469 TCCGCAGCTGCTGGCCCGGGTGG + Intergenic
968542244 4:1173415-1173437 CCTGCAGCCCCAGCCCTGTGCGG - Intronic
968668299 4:1833662-1833684 TCTGCAGTTCCTACCACCTGAGG + Intronic
968932735 4:3590602-3590624 TGGGCAACTCCTGCCCCCTGTGG + Intronic
969488612 4:7486146-7486168 CCTGCAGCACCTGCCTCCTGAGG + Intronic
969942006 4:10742072-10742094 TCTACAGATCCTGGCCCCTGTGG + Intergenic
971216085 4:24663331-24663353 TTTGCAGCTCCTGCCATATGTGG - Intergenic
973542058 4:51944737-51944759 TCTCGAGCTCCAGCCCTGTGAGG - Intergenic
973878111 4:55241614-55241636 TCTGCAGCTGCTGGCCCCGGGGG - Intergenic
982086424 4:151841178-151841200 TCTCCAGCTCCAGCCTGGTGAGG + Intergenic
982702418 4:158671704-158671726 TCTGCAGCATCTTCCCCGGGCGG - Exonic
983734710 4:171043295-171043317 TCCGCAGCTGCTGGCCCGGGTGG - Intergenic
984305413 4:177983187-177983209 TTTGCACCTTCTGCCCTGTGAGG + Intronic
985171831 4:187158226-187158248 TCTGCAGCTCCTCAACGGTGTGG + Intergenic
985569831 5:638915-638937 TCAGCAGTGCCTGCCCAGTGAGG - Intronic
985893768 5:2737463-2737485 TCTGCAGAGCCTGCTACGTGGGG + Intergenic
987037914 5:14036653-14036675 TCAGCAGCTGCTGCCCCAAGTGG - Intergenic
989682986 5:44051395-44051417 ACTGCAGCCCCTGCCTCCTGTGG + Intergenic
991227774 5:64292754-64292776 TCAGCAGCCCCTCCCCCATGGGG + Intronic
991437380 5:66610546-66610568 TGAGCCGCTCCTGCCCCTTGGGG + Intronic
993018459 5:82563416-82563438 TCGGGAGATCCTGCCCAGTGAGG - Intergenic
994242866 5:97444770-97444792 TCAGGAGGTCCTGCCCAGTGAGG + Intergenic
995325623 5:110886593-110886615 TCTGCAGCTGCTGGCACTTGTGG + Intergenic
997065591 5:130555545-130555567 TCAGCAGGTCCTGACCAGTGAGG - Intergenic
998132792 5:139659718-139659740 TCGGCAGCTGCTGCCCCGCCTGG + Intronic
999196760 5:149786652-149786674 TCAGCAGCTCATGTCCAGTGGGG - Intronic
1002641679 5:180633455-180633477 TCTGCAGCCCCTTCCCCTTGGGG + Intronic
1002665777 5:180823483-180823505 GCTGCAGCTCCTGCCCTGGCAGG - Intergenic
1002793207 6:450118-450140 TCCGCAGTTGCTGGCCCGTGTGG - Intergenic
1003046233 6:2735608-2735630 GCTGCAGCTCCGTCCCCATGGGG - Intronic
1003488153 6:6597303-6597325 CCTGGAGCTCCTGCCTCATGGGG - Intronic
1003559679 6:7170389-7170411 TCTGCTGCTCCTGGGCAGTGAGG - Intronic
1004483232 6:16040558-16040580 TCTGCAGCTGCTGGCCTGGGTGG + Intergenic
1006681088 6:35797221-35797243 TATGCAGCTCCTGGCCCCCGGGG - Exonic
1007396487 6:41580942-41580964 TCTCCAGCTCCAGCCTAGTGAGG + Intronic
1008090257 6:47286410-47286432 TCTGCAGCAGTTGCCCTGTGGGG - Exonic
1010161111 6:72856895-72856917 TCTGCATCTCCAGCCCCACGGGG - Intronic
1010205031 6:73314980-73315002 TCTGTTCCTCCTGCCCCGCGCGG - Intergenic
1012962314 6:105635157-105635179 TCTGCAATTCCTGCCCAGTGGGG + Intergenic
1013168000 6:107611005-107611027 TCAGCAGGTGCTGCCCAGTGGGG + Intronic
1013631852 6:111993469-111993491 TCTGTGGCACCTGCCACGTGGGG + Intergenic
1015786354 6:136923506-136923528 CCCGGAGCCCCTGCCCCGTGGGG - Intronic
1016034867 6:139374786-139374808 TCTGCAGCACGTGCCGCGGGCGG - Intergenic
1018054589 6:160040984-160041006 TCTGCAGCCTCTGCCCCCTGGGG + Intronic
1018702918 6:166441637-166441659 TCTCCTTCTCCGGCCCCGTGCGG + Intronic
1019293061 7:259755-259777 TCTGCAGCTCCTGGCCAAGGAGG + Exonic
1020116547 7:5479597-5479619 TCTACAGCCCCTGCCCCCTGGGG + Intronic
1022045610 7:26620056-26620078 TCTTCAGTCCCTGCCCCATGTGG + Intergenic
1022727270 7:32992390-32992412 TCTGCAGCTCCTGCTGGGGGTGG - Intronic
1023662871 7:42488649-42488671 TCTGCAGCCCCTGCTTCCTGGGG + Intergenic
1023855783 7:44182910-44182932 TCTGCAGCTGCTGCTCACTGCGG - Intronic
1024211941 7:47213576-47213598 TCAGCAACTCCTGACCAGTGTGG - Intergenic
1024308408 7:47947422-47947444 CCTGCAGATCTTGCCCAGTGGGG - Intronic
1024472254 7:49775759-49775781 TCTGCAGGTCCGGCCCCGCGGGG + Exonic
1024537119 7:50446188-50446210 TCTGTAGGTCCTGCCCCATAAGG + Exonic
1025046313 7:55695259-55695281 TCTGCAGCTCCTGCTGGGGGTGG + Intergenic
1029706876 7:102280791-102280813 TCTGCCGCTCCTGCACAGGGAGG - Intronic
1032530425 7:132615385-132615407 TCTGCAGCCCCCGCCCCTGGCGG + Intronic
1034489411 7:151385399-151385421 GCGGCTGCTCCTGCCCCATGGGG + Intronic
1034753196 7:153590312-153590334 TTTGGAGCTCCTGCTCTGTGTGG + Intergenic
1034964329 7:155382346-155382368 CCAGCAGCCCCTGCCCTGTGCGG + Intronic
1035528041 8:329400-329422 TTTTCACCTCCTGCCGCGTGAGG - Intergenic
1037890854 8:22623078-22623100 TCTGCCCCTCCTGGCCCGGGTGG - Intronic
1037971344 8:23174024-23174046 TCCGCAGCTGCTGGCCCGGGGGG + Intergenic
1039482136 8:37882094-37882116 CCTGAAGCTCCTGCCCTGGGCGG - Intronic
1040003878 8:42601561-42601583 GCTGCAGCTCCTGTCCAGTGAGG - Intergenic
1040402736 8:47068692-47068714 TGTGCAGCTGCTGGCACGTGTGG + Intergenic
1048931335 8:139317715-139317737 GCTGCAGCCACTGCCCCTTGTGG + Intergenic
1049443179 8:142618395-142618417 TCAGCAGCTCCTGCAGCCTGTGG - Intergenic
1049742539 8:144248029-144248051 TCTTCAGCGGCTGCCCTGTGTGG + Intronic
1049991966 9:999186-999208 CCTGCCGGTCCTGCGCCGTGGGG - Intergenic
1053238823 9:36479444-36479466 TCTGCATCTCCTCCCATGTGGGG + Intronic
1054457390 9:65441293-65441315 TGGGCAACTCCTGCCCCCTGTGG - Intergenic
1056788143 9:89606964-89606986 TCTGCAGGCCCTGCCCTTTGTGG + Intergenic
1056789522 9:89616570-89616592 CCTGCTGCTCCCTCCCCGTGGGG + Intergenic
1057210987 9:93201055-93201077 TGTGCAGCCCCTCCCCAGTGAGG + Intronic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1058578581 9:106430428-106430450 TCTCCAGCCTCTGCCCAGTGTGG + Intergenic
1059488062 9:114642924-114642946 TCTGCAACTCATGGCCTGTGGGG - Intronic
1061409826 9:130414223-130414245 TGGGAAGCTCCTCCCCCGTGTGG + Intronic
1062035534 9:134380983-134381005 CCTGCACCTCCTGCCCGCTGGGG - Intronic
1062216470 9:135392300-135392322 GCTGGAACTCCTGGCCCGTGTGG - Intergenic
1062610023 9:137369437-137369459 TCTGCTCCTCCTGCCGCATGTGG + Intronic
1062623716 9:137433837-137433859 ACTGCAGCTGCAGCCCCCTGGGG - Exonic
1186182968 X:6990722-6990744 TCTGCAGTTCCCGGCCCATGCGG - Intergenic
1186655975 X:11612524-11612546 TCTGCCCCTTCTGCCACGTGAGG + Intronic
1187000606 X:15172926-15172948 TCTGAATCTCCTTCCCCGTCTGG - Intergenic
1191846638 X:65551878-65551900 TCTGGAGCTCCCGCCCCTTTGGG + Intergenic
1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG + Intergenic
1192760224 X:74088631-74088653 TCGGAAGGTCCTGCCCAGTGAGG - Intergenic
1193739691 X:85202998-85203020 CCTGCAGGACCTGCCCAGTGAGG + Intergenic
1194187986 X:90797560-90797582 TGTGCAGCTGCTGGCCCTTGTGG + Intergenic
1195569840 X:106385762-106385784 TCTCCAGCACCTGCCCAGTGAGG + Intergenic
1196398382 X:115289685-115289707 TCTGCTCCTCCTGCGCGGTGAGG + Intergenic
1198087604 X:133295341-133295363 TCTGCACATACTGCCCTGTGGGG + Intergenic
1198648741 X:138837921-138837943 TTGGGAGCTCCTGCCCAGTGAGG + Intronic
1200110163 X:153736899-153736921 TCTGCAGCACCTGCCTCCCGTGG - Intronic
1200164364 X:154026021-154026043 TCTGGAGGACCTGCCCGGTGGGG - Intronic
1200534576 Y:4379506-4379528 TGTGCAGCTGCTGGCCCTTGTGG + Intergenic
1200547325 Y:4533436-4533458 TCTGGAGGTCCTGGCCAGTGAGG - Intergenic
1200761902 Y:7046427-7046449 TGTGCAGCTCCTGGCACTTGCGG - Intronic