ID: 1057397416

View in Genome Browser
Species Human (GRCh38)
Location 9:94692430-94692452
Sequence TACCTCCGCCCTATGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057397416_1057397426 21 Left 1057397416 9:94692430-94692452 CCCCAGGGCATAGGGCGGAGGTA No data
Right 1057397426 9:94692474-94692496 TTCTGAGGGCAAAGGGAGTTCGG No data
1057397416_1057397425 14 Left 1057397416 9:94692430-94692452 CCCCAGGGCATAGGGCGGAGGTA No data
Right 1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG No data
1057397416_1057397422 7 Left 1057397416 9:94692430-94692452 CCCCAGGGCATAGGGCGGAGGTA No data
Right 1057397422 9:94692460-94692482 TGGCTAACCTTCTGTTCTGAGGG No data
1057397416_1057397421 6 Left 1057397416 9:94692430-94692452 CCCCAGGGCATAGGGCGGAGGTA No data
Right 1057397421 9:94692459-94692481 GTGGCTAACCTTCTGTTCTGAGG No data
1057397416_1057397427 29 Left 1057397416 9:94692430-94692452 CCCCAGGGCATAGGGCGGAGGTA No data
Right 1057397427 9:94692482-94692504 GCAAAGGGAGTTCGGATCCTTGG No data
1057397416_1057397423 13 Left 1057397416 9:94692430-94692452 CCCCAGGGCATAGGGCGGAGGTA No data
Right 1057397423 9:94692466-94692488 ACCTTCTGTTCTGAGGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057397416 Original CRISPR TACCTCCGCCCTATGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr