ID: 1057397425

View in Genome Browser
Species Human (GRCh38)
Location 9:94692467-94692489
Sequence CCTTCTGTTCTGAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057397416_1057397425 14 Left 1057397416 9:94692430-94692452 CCCCAGGGCATAGGGCGGAGGTA No data
Right 1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG No data
1057397418_1057397425 12 Left 1057397418 9:94692432-94692454 CCAGGGCATAGGGCGGAGGTAGA No data
Right 1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG No data
1057397413_1057397425 19 Left 1057397413 9:94692425-94692447 CCACTCCCCAGGGCATAGGGCGG No data
Right 1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG No data
1057397417_1057397425 13 Left 1057397417 9:94692431-94692453 CCCAGGGCATAGGGCGGAGGTAG No data
Right 1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057397425 Original CRISPR CCTTCTGTTCTGAGGGCAAA GGG Intergenic
No off target data available for this crispr