ID: 1057398929

View in Genome Browser
Species Human (GRCh38)
Location 9:94705156-94705178
Sequence TAGTGGGAGGGGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057398929_1057398937 -3 Left 1057398929 9:94705156-94705178 CCTACTTCCCTCCCCTCCCACTA No data
Right 1057398937 9:94705176-94705198 CTAGCTGTTAGAAGTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057398929 Original CRISPR TAGTGGGAGGGGAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr