ID: 1057400595

View in Genome Browser
Species Human (GRCh38)
Location 9:94719905-94719927
Sequence TTCTATTACTAGGGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057400589_1057400595 -9 Left 1057400589 9:94719891-94719913 CCACAAAATCAGCATTCTATTAC No data
Right 1057400595 9:94719905-94719927 TTCTATTACTAGGGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057400595 Original CRISPR TTCTATTACTAGGGGGAAGA GGG Intergenic
No off target data available for this crispr