ID: 1057401511

View in Genome Browser
Species Human (GRCh38)
Location 9:94727102-94727124
Sequence GACTGGAGATGAGCCCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057401511 Original CRISPR GACTGGAGATGAGCCCTGTG GGG (reversed) Intronic
900514910 1:3077047-3077069 GCCTGGAGACCTGCCCTGTGGGG - Intronic
900641230 1:3689003-3689025 GGCTGAGGATGTGCCCTGTGGGG + Intronic
901158246 1:7155026-7155048 GGCTGGAGAAGGGCCCAGTGTGG - Intronic
901775405 1:11557153-11557175 GAGTGGAGAAGAGCCCAGGGAGG - Intergenic
905289757 1:36913185-36913207 GTTTGGAGATGAGCCCAGTTGGG - Intronic
907239632 1:53074346-53074368 GAGTGGGGATGACCCCTGAGAGG - Intronic
914171941 1:145233371-145233393 GACCGGGGATGAACCCTGTCGGG + Intergenic
915088155 1:153402537-153402559 GACAGGAGATGAGGTCTGAGGGG + Intergenic
915211565 1:154313364-154313386 GAGTGGAGATGAGCCCCCAGAGG - Intergenic
915212695 1:154322335-154322357 GAGTGGAGATGAGCCCCCAGAGG - Intronic
915273724 1:154773797-154773819 GACCTGAGCTGAGCCCTGTAAGG + Intronic
915466711 1:156102607-156102629 AAATGGAGATGAGCACTGGGTGG - Intronic
916139167 1:161678670-161678692 AACTTCAGATGAGCCCTGAGTGG + Intergenic
917255678 1:173113554-173113576 GACTGGAGATGAGCTCAGAAAGG + Intergenic
918069241 1:181122870-181122892 GACTGGAGGTGAGTGCAGTGAGG + Intergenic
920561370 1:206941160-206941182 GACTTGATATCAGCCCTGTGAGG + Intronic
921232941 1:213092184-213092206 GACTGCAGATGATCCCTGCAGGG - Intronic
921951434 1:220934361-220934383 GAGTTGAGAGGAGCCCAGTGGGG - Intergenic
924905942 1:248452839-248452861 GATGGGTGATGAGGCCTGTGAGG - Exonic
924921947 1:248639195-248639217 GATGGGTGATGAGGCCTGTGAGG + Exonic
1069291141 10:66781156-66781178 CAGTGCAGAGGAGCCCTGTGTGG + Intronic
1070382302 10:75891927-75891949 GAATTGAGAGGACCCCTGTGGGG + Intronic
1070512723 10:77176142-77176164 GACTTCAGCTGAGCCCTGGGTGG + Intronic
1070522580 10:77267233-77267255 GACTGGGGAGGAGCTCTGTGTGG + Intronic
1072563594 10:96599166-96599188 CACTGGATATGAGAGCTGTGAGG + Intronic
1075421124 10:122301468-122301490 GAAGGGAAAAGAGCCCTGTGTGG + Intronic
1075811328 10:125227055-125227077 AACTGGAGGTGAGCCCTGGCAGG + Intergenic
1075960821 10:126566680-126566702 GACTGGAGCTGGTGCCTGTGGGG + Intronic
1076107630 10:127835827-127835849 CACTGGAGTAGAGACCTGTGTGG - Intergenic
1076725326 10:132410436-132410458 GACTGGATGTGTGCACTGTGCGG + Intronic
1077242685 11:1518949-1518971 GACTCCAGAGCAGCCCTGTGGGG - Intergenic
1077326100 11:1964795-1964817 GACGGGAAATGAGACCTGCGAGG - Intronic
1079935814 11:26614618-26614640 GACTGGATTTGAGGCCTGTGGGG + Intronic
1081675716 11:44967870-44967892 GGGTGGAGATGGGCCCTGGGAGG + Intergenic
1084488456 11:69464543-69464565 CACAGGGCATGAGCCCTGTGGGG - Intergenic
1086339971 11:85838718-85838740 TGCTGGAGATGAGCCCTGGTGGG - Intergenic
1087683882 11:101241888-101241910 GACTGTGGGTAAGCCCTGTGAGG + Intergenic
1088872687 11:113904845-113904867 GAGTGGAGAGGAACCCTGTTAGG + Exonic
1089280117 11:117368371-117368393 GCCTGGAGGTGAGCCATGAGAGG + Intronic
1091297709 11:134485578-134485600 GAATGGAGAGGAACCCTGAGTGG + Intergenic
1202809080 11_KI270721v1_random:19974-19996 GACGGGAAATGAGACCTGCGAGG - Intergenic
1091666074 12:2419430-2419452 GACTGGAGGTGGGCCTGGTGGGG - Intronic
1092144557 12:6205489-6205511 GACTCTAGATGAGCCCTCTGCGG + Intronic
1092286433 12:7131450-7131472 GACCGGAGATGAGGCGTGGGAGG + Intronic
1098387451 12:69934302-69934324 GACTGGCCATGAGCCCTGCATGG - Intronic
1100594481 12:96060278-96060300 GAGTGGAGATGAGTTCTGGGCGG + Intergenic
1101913615 12:108879633-108879655 GACTGGAGGTGACGCCTGTGTGG - Intronic
1102042973 12:109812309-109812331 GACTGGAGAGAAGCCCTGGATGG - Intronic
1102666354 12:114577341-114577363 GACTGGAGCTCAGCCCTGGTGGG + Intergenic
1105619561 13:22053644-22053666 GACTGGAGATGAAGCCAGCGAGG - Intergenic
1108438720 13:50427162-50427184 GACTGGAACTGTGCCCTGGGAGG - Intronic
1114389813 14:22294969-22294991 TACTGTAGAGGAGGCCTGTGTGG - Intergenic
1114529095 14:23384355-23384377 GAGGTGAGAGGAGCCCTGTGAGG + Intronic
1114776880 14:25494082-25494104 GTCTGGAGAAGACGCCTGTGGGG + Intergenic
1115137327 14:30126853-30126875 TCCTGGAGATGAGCCCAGTTAGG - Intronic
1117644843 14:57841037-57841059 GACTGTAGATGAGCTCCATGGGG - Intronic
1118259930 14:64236926-64236948 GACTGGACATGAGTGCTTTGAGG + Intronic
1120385886 14:83845293-83845315 GAAAGGAGAAGAGGCCTGTGAGG - Intergenic
1122727463 14:103767488-103767510 GACTGGAGACGAGCCTTGTGAGG - Intronic
1123411874 15:20067536-20067558 CACTGGAGAAGAGGCCTCTGGGG + Intergenic
1123521218 15:21074655-21074677 CACTGGAGAAGAGGCCTCTGGGG + Intergenic
1123578302 15:21694737-21694759 CACTGGAGAAGAGGCCTCTGGGG + Intergenic
1123614927 15:22137219-22137241 CACTGGAGAAGAGGCCTCTGGGG + Intergenic
1124159431 15:27255176-27255198 GCCTGAGGATGAGCCCTGTGGGG - Intronic
1126402612 15:48288753-48288775 GACTTGAGATGAGGCTTCTGTGG - Intronic
1126686561 15:51253339-51253361 GACTGGAGTTGTGCCCTCAGGGG + Intronic
1128338733 15:66805094-66805116 GACTGGAGGTGACTCCTGTAGGG + Intergenic
1128392452 15:67191403-67191425 GACTGGAGACGCACCCAGTGTGG - Exonic
1129115621 15:73363903-73363925 GACTGCTGTGGAGCCCTGTGTGG - Intronic
1131671671 15:94626360-94626382 GGATGGAGATCAGCCCTGAGAGG + Intergenic
1202987172 15_KI270727v1_random:428982-429004 CACTGGAGAAGAGGCCTCTGGGG + Intergenic
1132543344 16:521628-521650 GACCTGAGATGACCGCTGTGTGG + Exonic
1132850853 16:2024268-2024290 GGCTGGAGAAGAGGCCTGGGAGG + Intergenic
1134763430 16:16734394-16734416 GACGGGAGATGAGGCCATTGAGG - Intergenic
1134982622 16:18624763-18624785 GACGGGAGATGAGGCCATTGAGG + Intergenic
1136293257 16:29288368-29288390 GACTGGAGAGGGGCCATTTGGGG + Intergenic
1138413818 16:56859794-56859816 GACTGGCAAGGAGGCCTGTGTGG - Intergenic
1140493700 16:75364056-75364078 GATTGGAGATGTGTCCTCTGAGG + Intronic
1141636248 16:85315434-85315456 GACTGGGGATTGGCCCTGAGAGG + Intergenic
1141658615 16:85429661-85429683 GACAGGGGAGGAGGCCTGTGGGG - Intergenic
1142099141 16:88262375-88262397 GACTGGAGAGGGGCCATTTGGGG + Intergenic
1142371555 16:89685840-89685862 GACAGGAGAGAAGCTCTGTGAGG - Intronic
1142943379 17:3402621-3402643 AAATGGAGAGTAGCCCTGTGTGG + Intergenic
1145899453 17:28480748-28480770 GACTGGTCTGGAGCCCTGTGTGG + Intronic
1145999220 17:29121447-29121469 GAGTGGACAGGAGCCCAGTGGGG + Intronic
1146724215 17:35144517-35144539 GCCTGGAGATGGGCCCTGAAAGG + Intergenic
1151140160 17:71984008-71984030 GCCTGGAAATGAGATCTGTGGGG - Intergenic
1151334094 17:73430026-73430048 GGCAGGAGATGACCCCTGGGGGG - Intronic
1151405100 17:73881119-73881141 GACTGGGGGTGGGCCCTGTTAGG - Intergenic
1151943618 17:77307391-77307413 TGCTGGAGATGATCCTTGTGGGG + Intronic
1152136166 17:78505029-78505051 GACGGGAGAAAAGCCCTGTTCGG - Intronic
1152521477 17:80859128-80859150 AACTGGTCAGGAGCCCTGTGCGG + Intronic
1153332939 18:3892360-3892382 CACTGGAGCTGAGCTGTGTGGGG - Intronic
1154392072 18:13946470-13946492 AACTGGAGATGAGGTCGGTGAGG - Intergenic
1154494815 18:14947869-14947891 TTCTGGAGATGGGCCCTTTGTGG + Intergenic
1156456198 18:37295963-37295985 AGCTGGAGAGGAGCTCTGTGAGG + Intronic
1157231331 18:45919276-45919298 CACTAGAGATCAGCCCTGAGAGG + Intronic
1157546556 18:48550572-48550594 GAGTGGAGAGGAGCCCAGAGGGG - Intronic
1157569517 18:48703333-48703355 GCCTGGTGAGGAGCCCGGTGTGG + Intronic
1157719150 18:49910217-49910239 AACTGGAGGAGAGCCCAGTGTGG + Intronic
1158608743 18:58919542-58919564 GACTGGAGAGGCGCCCTGGGGGG - Exonic
1159142064 18:64409314-64409336 GTCTTGAGATGAGCTCTGAGTGG + Intergenic
1159409075 18:68046250-68046272 GACTGGAGCAGAGCCATTTGAGG + Intergenic
1159475601 18:68916896-68916918 GTCTGGACAGGAGCCCTGTGTGG + Intronic
1160096180 18:75875731-75875753 CAGTGGAGAGGAGCCCCGTGTGG + Intergenic
1160562961 18:79771018-79771040 GTGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160562973 18:79771052-79771074 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160563137 18:79771511-79771533 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160787267 19:906722-906744 GACAGGAAATGAGCCCAATGTGG - Intronic
1160787458 19:907654-907676 GCCTGGAGGAGAGGCCTGTGGGG - Intronic
1160802695 19:977561-977583 GCCTGGAGCTGAGGCCTCTGGGG + Intergenic
1161315283 19:3614699-3614721 GACTGGATGGGACCCCTGTGGGG - Intronic
1165404021 19:35619113-35619135 AACTGGGCCTGAGCCCTGTGTGG + Intronic
925921902 2:8644192-8644214 GATGGGAGATGAGCCCAGAGTGG - Intergenic
928304543 2:30156729-30156751 GAGTGGAGATGAGTTCTGAGCGG - Exonic
929999262 2:46849918-46849940 AACTGGAGCTGAGCCCAGAGAGG + Intronic
930108390 2:47657743-47657765 TACTGGAGCTGAGCCCAGTGGGG + Intergenic
931702444 2:64919906-64919928 GAATGAAAATGAGTCCTGTGGGG - Intergenic
933336662 2:80967654-80967676 CACTGGAGATGAGATCTGGGGGG - Intergenic
933780194 2:85795854-85795876 GGCTGCAGATGGGCCCTGGGAGG - Intergenic
933897340 2:86823912-86823934 GACTGAGGAGGAGCCCTGGGGGG + Intronic
934752090 2:96799943-96799965 GCTTGGAGAGGAGGCCTGTGGGG + Intronic
935316784 2:101842746-101842768 GACTGCAGAAGACTCCTGTGTGG + Intronic
935574683 2:104696808-104696830 GAATGGAGTTGAACACTGTGTGG + Intergenic
935698129 2:105787363-105787385 ATTTGGAGATGAGCCCTCTGAGG + Intronic
935738615 2:106126877-106126899 GGCTGTAGAAGGGCCCTGTGAGG - Intronic
937251668 2:120527792-120527814 GCCTGGGGATGAGTCCTGGGTGG + Intergenic
937362462 2:121238576-121238598 GTCTGGGGATCAGCCCTGCGAGG - Intronic
938140700 2:128792077-128792099 AACTGGAGATGCTCCCTGTGGGG + Intergenic
941857751 2:170247909-170247931 GAATGGTGAGGAGCACTGTGTGG + Intronic
943611872 2:190044378-190044400 GCCTGGTGATGAGCAGTGTGGGG + Intronic
944289045 2:197983695-197983717 GCCTGGTGATGAGGCCTGTAGGG + Intronic
945649469 2:212539583-212539605 GTCTGTAGATGAGCACCGTGGGG - Intergenic
946214110 2:218170370-218170392 GACTGGAGATCAGGGCTGGGAGG - Intergenic
946786293 2:223247340-223247362 GACTGGGGAAGAGCACTGTTCGG + Intergenic
1169111595 20:3037524-3037546 AAGTACAGATGAGCCCTGTGGGG - Intronic
1170279166 20:14626330-14626352 GCTTGGAGATGATACCTGTGGGG + Intronic
1172831360 20:37837984-37838006 GACTTGAGAATAGCCATGTGAGG + Intronic
1172894770 20:38292696-38292718 GATGGGAGATGAGCCAGGTGAGG - Intronic
1173961201 20:47073868-47073890 GACCAGAGATGAGCCCTATGAGG - Intronic
1174157417 20:48524783-48524805 GACTTGGGGTGAGCCCTGAGTGG - Intergenic
1174415136 20:50361117-50361139 GCCTGGGGCTGAGCCCAGTGAGG - Intergenic
1175993029 20:62798859-62798881 GACGGAAGCTGAGGCCTGTGTGG + Intronic
1178411272 21:32365662-32365684 GAGTAGAGAGGAGGCCTGTGTGG - Intronic
1179576800 21:42313010-42313032 GAGAGGAGATGACCCTTGTGGGG + Intronic
1179642763 21:42758057-42758079 GGCTGGAGGTGGGCCCTGGGTGG + Intronic
1179800122 21:43807821-43807843 GACTGGAGATGGGGCCTCTAAGG - Intergenic
1180002795 21:45002690-45002712 CACTGGAGTAGAGCCCTGTGAGG + Intergenic
1180041218 21:45281216-45281238 GAATGGAGCTGAGCCCAGAGGGG - Intronic
1180583122 22:16860210-16860232 GACTGGAGAGGCACCCTGGGGGG + Intergenic
1180968621 22:19803382-19803404 GACTTGGGATGAGGCCTGGGAGG - Intronic
1181466440 22:23113055-23113077 GCCTGGAGGTGAGCCCTGTGAGG - Intronic
1182121091 22:27787459-27787481 GACTTGAGATAAGCCAAGTGTGG - Intronic
1183266505 22:36829632-36829654 GAGAGGAGATGAGTCCTGGGGGG + Intergenic
1184003839 22:41694579-41694601 GACTGGAGATGAGAATGGTGAGG + Exonic
1184264801 22:43341362-43341384 GCCTGGAGATGGGCCCTCTCTGG - Intronic
1184676145 22:46044536-46044558 GCCGGGAGATGAGCCCAGAGCGG + Intergenic
1185015510 22:48340364-48340386 GCTTGGAGATGAGCCCCATGGGG + Intergenic
949104564 3:188458-188480 GTTTGGAGATGAACCCTTTGGGG - Intergenic
950836590 3:15925455-15925477 GACTGGAGAAGTGGTCTGTGTGG + Intergenic
954292530 3:49657263-49657285 GTCTGGGACTGAGCCCTGTGTGG + Exonic
955167593 3:56529512-56529534 AACTGGAGATGAGACTTGGGTGG + Intergenic
955671960 3:61411650-61411672 CACTAGAGATGATGCCTGTGTGG - Intergenic
956027160 3:64995436-64995458 GACTGGAGATGAGGCTGGAGAGG + Intergenic
958501194 3:94911155-94911177 GAATGAAGATGAGCACTTTGTGG + Intergenic
958986719 3:100788507-100788529 CACTGGCCATGTGCCCTGTGAGG - Intronic
960314986 3:116165727-116165749 GACAGCAGATGAGGCCTGTGGGG - Intronic
961037431 3:123652445-123652467 GACTGGACTTGTGCCATGTGAGG - Intronic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
962010167 3:131383983-131384005 GCATGGACATGAGTCCTGTGAGG + Intronic
962708134 3:138064271-138064293 GACTGGGGAGGAGCCCACTGTGG + Intronic
964310408 3:155386066-155386088 TTCTGGAAATCAGCCCTGTGTGG + Intronic
966920924 3:184610830-184610852 GACTAGATATGGGCCCTGAGAGG - Intronic
969092212 4:4703118-4703140 CACTGGAGATGAGCCCCGAGGGG + Intergenic
970894864 4:21090159-21090181 AACTTGAGATGAGCTCGGTGAGG - Intronic
973582709 4:52359872-52359894 GACTGGTGAGTAGCCCTGTTGGG - Intergenic
974819133 4:67044061-67044083 GGCTGGAGATAATACCTGTGAGG - Intergenic
978467118 4:109019723-109019745 AACTGGAGATGAGACTTGGGTGG + Intronic
982063504 4:151628423-151628445 AAGTGTAGATGAGCCCTGAGTGG - Intronic
982410650 4:155072565-155072587 GACTGGAGATCTGCCCTAAGTGG - Intergenic
985128224 4:186716286-186716308 GAGTGGAGAAGAGCACAGTGAGG - Intronic
985223169 4:187730051-187730073 TACTGGAGGTGAGCCCTCAGTGG - Intergenic
985362094 4:189186323-189186345 GCGTGGATATGAGCTCTGTGTGG - Intergenic
985674874 5:1225790-1225812 GACTGCAGGTGGGCCCTGAGGGG - Intronic
989428854 5:41328450-41328472 GACTGGTGATGAGGCATTTGGGG + Intronic
989514823 5:42329467-42329489 GATTGGATTTGAGCCCTTTGAGG + Intergenic
992615130 5:78540312-78540334 GACTGGAGATGATGTCTGTCTGG + Intronic
995314992 5:110759614-110759636 TACAGGAGATGAGGCCTGAGTGG + Intronic
995910848 5:117184642-117184664 GAATGTCGATGAGCCCTGTTAGG - Intergenic
997387853 5:133487763-133487785 GGCTGGAAATGAGCTCAGTGGGG - Intronic
1003746431 6:9007510-9007532 GACTAGAGCTGGGCCCTTTGGGG + Intergenic
1006030452 6:31173449-31173471 GGCTGGATATGAGCCCAGTCAGG + Intronic
1006374043 6:33662207-33662229 GACTGGAGATGGGCCGTTAGAGG + Intronic
1007453823 6:41960901-41960923 GCCTAGAGCTGTGCCCTGTGAGG - Intronic
1008439437 6:51515843-51515865 CATTGGAGATGAGGCCAGTGTGG - Intergenic
1011520164 6:88196159-88196181 GGCTGGAGCTGAGGCCTGAGGGG + Intergenic
1013290702 6:108716921-108716943 GTCTGAGGATGCGCCCTGTGTGG + Intergenic
1013474227 6:110492862-110492884 GACTGGAGGTGATACCTGAGAGG - Intergenic
1014038099 6:116791331-116791353 TACTGGAGAGGAGCCCTCTTCGG - Intergenic
1017694413 6:157000174-157000196 AACTGGAGATGCGTCCTGGGAGG + Intronic
1020149267 7:5668944-5668966 GGCTGGATAAGAGCCCTGTGGGG - Intronic
1023175845 7:37434678-37434700 GACTGGAGAGGAGGCCTGATTGG - Intronic
1025019947 7:55472981-55473003 GACCGGGGATGAACCCTGTCGGG - Exonic
1026386726 7:69857272-69857294 TCCTGGAAATGAGCCCTGAGAGG + Intronic
1027232698 7:76281843-76281865 TAGTGGAGGGGAGCCCTGTGCGG - Intronic
1028214570 7:88115625-88115647 GTCTGGAGATAAGGCCTGTGAGG - Intronic
1029950994 7:104585360-104585382 GAATGCTGAAGAGCCCTGTGCGG - Intronic
1031574001 7:123393818-123393840 GAGCAGAGCTGAGCCCTGTGTGG - Intergenic
1031627094 7:124004330-124004352 GTCTGGTGATGAGCCATGGGTGG + Intergenic
1032850604 7:135791841-135791863 GGCTGGAGCTGTGTCCTGTGAGG + Intergenic
1033246096 7:139717469-139717491 GCCTGGTGATGGGGCCTGTGTGG - Intronic
1033345951 7:140525899-140525921 GGCTGGAGGTGAGCCATTTGTGG + Intronic
1034075495 7:148227209-148227231 GAGTGAAGATGAGGCCTGAGAGG + Intronic
1035116896 7:156532438-156532460 GTTTGGAGATGGGGCCTGTGAGG - Intergenic
1035281082 7:157778939-157778961 GACTTGAGCTGAGCACTGTGTGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1038349775 8:26765370-26765392 GAGTGGAGATGATCACTGTGGGG - Intronic
1040654899 8:49496237-49496259 GACTGGAGCTGAGGACTGTGTGG + Intergenic
1041858485 8:62484177-62484199 GACAAGAGATGAGTCCAGTGAGG - Intronic
1046290827 8:112158227-112158249 GACAGGACATGGGCCTTGTGTGG - Intergenic
1047252923 8:123194117-123194139 GACTGGAGATTTGTCCTGTCTGG + Exonic
1049713452 8:144078169-144078191 GACTGGAGAGGTGCCAGGTGTGG + Intergenic
1051073931 9:13207421-13207443 GAATGGAAGTGAGCCCTCTGTGG - Intronic
1052728245 9:32256285-32256307 GAATTGAGATGAGGTCTGTGTGG - Intergenic
1054708100 9:68483481-68483503 CACTGGAGAAGAGACCAGTGTGG + Intronic
1054854057 9:69879066-69879088 TACTGGAGGTGAGGCCTGGGGGG - Intronic
1056820983 9:89841982-89842004 GACTGGAAATCAGCCCGGGGTGG - Intergenic
1057401511 9:94727102-94727124 GACTGGAGATGAGCCCTGTGGGG - Intronic
1059350120 9:113658500-113658522 TACTGGAGATGAGCACAGTCAGG - Intergenic
1059471826 9:114510876-114510898 GACTGGATGCAAGCCCTGTGAGG + Intergenic
1060072067 9:120558619-120558641 GACTGGAAAGGAGGCCAGTGAGG - Intronic
1060848274 9:126854523-126854545 GAATGGAGAGGAGCCCTTTGGGG - Intergenic
1061247492 9:129408196-129408218 CACTGGAGCTGAGACCTGGGTGG - Intergenic
1061733941 9:132639319-132639341 GACTGGAGAAGAGCTGGGTGGGG - Intronic
1185430899 X:11162-11184 GGTTGGAGCTGAGCCCTGTCGGG + Intergenic
1185440165 X:223559-223581 GGTTGGAGCTGAGCCCTGTCGGG + Intergenic
1188978901 X:36708498-36708520 GACAGTGTATGAGCCCTGTGTGG + Intergenic
1189253432 X:39619253-39619275 CATGGGAGATGAACCCTGTGAGG + Intergenic
1189994597 X:46626604-46626626 AACTTGAGATGAGACTTGTGGGG - Intronic
1190396858 X:49993836-49993858 GACTTGAGAAGAGATCTGTGGGG + Intronic
1190825560 X:54014933-54014955 ACCTGGAACTGAGCCCTGTGAGG - Intronic
1191105689 X:56770781-56770803 GACTCTAGCTGACCCCTGTGAGG + Intergenic
1191106682 X:56776183-56776205 GACTCTAGCTGACCCCTGTGAGG + Intergenic
1192155759 X:68745421-68745443 GCTCAGAGATGAGCCCTGTGAGG - Intergenic
1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG + Intergenic
1192891936 X:75399439-75399461 GTCTGGTGATGAGCCATGGGTGG - Intronic
1194841617 X:98751430-98751452 AACTGGAGATGAGATTTGTGTGG + Intergenic
1196881324 X:120200672-120200694 GATTGGAGCTAAGGCCTGTGGGG + Intergenic