ID: 1057401986

View in Genome Browser
Species Human (GRCh38)
Location 9:94731621-94731643
Sequence TATCACATAGCACAGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057401986_1057401988 7 Left 1057401986 9:94731621-94731643 CCTGGTTTCTGTGCTATGTGATA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1057401988 9:94731651-94731673 AGAGCAGTTCTTTTGCATTTGGG No data
1057401986_1057401987 6 Left 1057401986 9:94731621-94731643 CCTGGTTTCTGTGCTATGTGATA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1057401987 9:94731650-94731672 TAGAGCAGTTCTTTTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057401986 Original CRISPR TATCACATAGCACAGAAACC AGG (reversed) Intronic
903987344 1:27238170-27238192 TATCACAGAGCAGAGAGACCTGG - Intronic
904338955 1:29820344-29820366 GATTTCATAGCACAGAACCCTGG - Intergenic
906258969 1:44371893-44371915 TATCACATACTACAGAACCCAGG + Intergenic
906516881 1:46444698-46444720 CATCACAAAGCAAAGAAAACAGG + Intergenic
908742113 1:67339622-67339644 TTTCACAAAGCACTGAAAGCTGG + Intronic
911704971 1:101000239-101000261 TATCACATAGCACAAGATCAGGG - Intronic
915239138 1:154507399-154507421 TTTCACATTGAACAGAAACTGGG - Intronic
917178477 1:172265644-172265666 AATCAAATAGAACAAAAACCTGG - Intronic
919387027 1:196935189-196935211 TTTCAAATAGAAGAGAAACCAGG + Intronic
920846420 1:209596467-209596489 TACCACACAGCACCTAAACCTGG + Intronic
920924108 1:210326037-210326059 TATCACATAGCACCCATGCCAGG + Intergenic
923752381 1:236757826-236757848 TATGAAACAGCACACAAACCTGG - Intronic
923930956 1:238696135-238696157 GATCACATAGCAGTGAAATCAGG - Intergenic
1063160523 10:3415204-3415226 TCTCTAATAGCACAGAACCCAGG + Intergenic
1063830879 10:9951164-9951186 TATCTTATAGCACAGATACCAGG - Intergenic
1064666138 10:17653886-17653908 TATCACAAAAAACACAAACCAGG - Intronic
1068106793 10:52628272-52628294 TTTCACATAGATCAGCAACCTGG + Intergenic
1069950409 10:72014710-72014732 AATCACAGAGCAGAGAAGCCTGG + Intergenic
1070414379 10:76175915-76175937 TATGACAGAGAACAGAAACAGGG + Intronic
1070587730 10:77779370-77779392 TTCCACATAACACAGAAAACAGG - Intergenic
1074427483 10:113364688-113364710 AATCTCATAGAACAGCAACCTGG - Intergenic
1074727785 10:116331383-116331405 TATCACACAGCATAGAGACAGGG - Intronic
1075150687 10:119927510-119927532 TATGACATAGAAAAGAAGCCTGG - Intronic
1077563581 11:3281827-3281849 CTTTACTTAGCACAGAAACCTGG - Intergenic
1077569471 11:3327642-3327664 CTTTACTTAGCACAGAAACCTGG - Intergenic
1079014853 11:16859930-16859952 TTTCCGATAACACAGAAACCTGG - Intronic
1079698511 11:23514513-23514535 TATCACATTGTCCAAAAACCAGG - Intergenic
1085621127 11:78038614-78038636 TCTCACACAGCCCAGACACCTGG + Intronic
1085784174 11:79437193-79437215 TCACACATAGCACAAAAAACAGG - Intronic
1087670336 11:101098973-101098995 TATCACATGGTATAGGAACCTGG + Intronic
1087810734 11:102606832-102606854 AATCACACAGCTCAGCAACCAGG - Intronic
1088279686 11:108123402-108123424 TACAAAATAGCACAGAAAACTGG - Intronic
1088308641 11:108436859-108436881 TATCACATTTCATAGAAATCTGG - Intronic
1090759898 11:129827125-129827147 TAGCACATAGCACACAAAGTGGG - Intronic
1094279774 12:28723224-28723246 AATCAGAAAGCACAGAAAACAGG - Intergenic
1099665704 12:85626289-85626311 TTTCAAATAGCAAAAAAACCAGG - Intergenic
1100118220 12:91335662-91335684 TATTACATAGCAATGAAACATGG + Intergenic
1102336269 12:112083161-112083183 GATCAAATAGAAAAGAAACCTGG + Intronic
1103685391 12:122728538-122728560 TATCTCAGAAAACAGAAACCGGG - Exonic
1104299456 12:127550980-127551002 AACCACATAGCACAGAAGCAAGG + Intergenic
1107180406 13:37452279-37452301 AATCACATTACTCAGAAACCTGG - Intergenic
1108381487 13:49859081-49859103 TCTCACAAGGGACAGAAACCAGG - Intergenic
1108751830 13:53455701-53455723 TATCAGAGAGAACAGAAACTGGG + Intergenic
1109167509 13:59054347-59054369 TAACACATAGCCCAGAAATAAGG + Intergenic
1111508275 13:89224862-89224884 TATGAAATAGCACAGAACCAAGG + Intergenic
1111701101 13:91690833-91690855 TAGCACATATCTTAGAAACCTGG + Intronic
1112696280 13:101952645-101952667 TATCACCTATCAAAGAAACCTGG + Intronic
1112993844 13:105547973-105547995 TATCATAAAGCACAGATACTGGG - Intergenic
1114197347 14:20490643-20490665 TCTCAAAGAGCACAGGAACCTGG + Intergenic
1115117139 14:29894799-29894821 GATCACATAGCACACAGTCCAGG - Intronic
1117477309 14:56109378-56109400 TTTCACTTAACACAGAGACCAGG - Intergenic
1118739120 14:68725707-68725729 TACCATATAGCACAGAACCGGGG + Intronic
1120021120 14:79531435-79531457 TATGACATGGCACAGTATCCAGG + Intronic
1123205419 14:106708191-106708213 TATTACATATAACAGACACCTGG + Intergenic
1125069159 15:35531427-35531449 TATCACATATCATAGTAACATGG + Intronic
1127272269 15:57412498-57412520 TATCACATTTCCCAGGAACCTGG + Intronic
1127290739 15:57568591-57568613 TATAACACAGCACAGGAAACAGG - Intergenic
1130787561 15:87116988-87117010 TATCACAGATCACTGAAACCTGG - Intergenic
1135513902 16:23113331-23113353 TATCACATGAGACAGAACCCAGG + Intronic
1140416837 16:74780168-74780190 TATGACATAGCAGTGAAAACTGG - Intergenic
1148519539 17:48258339-48258361 TTTCACATAATATAGAAACCAGG - Intronic
1148907821 17:50922392-50922414 TATTACATAGCACAGACTTCAGG - Intergenic
1149811356 17:59676547-59676569 TATCATATAGCAGATAAACCTGG + Intronic
1150540770 17:66096575-66096597 TCTCACATACCAGAGAAACTGGG + Exonic
1151148268 17:72061813-72061835 GATCACAAAACACAGAAACAAGG + Intergenic
1152814897 17:82401859-82401881 TGTCACACGGCACAGAAAGCTGG + Intronic
1153404388 18:4719847-4719869 AATTATATAGCAGAGAAACCAGG + Intergenic
1153479631 18:5534216-5534238 TAGCATAGAGCAAAGAAACCTGG - Intronic
1157201161 18:45661077-45661099 GAACACATAGCACAGAATCTGGG + Intronic
1158585287 18:58727768-58727790 TATCATATAGCACAGTAGCGAGG + Intronic
1158635454 18:59152289-59152311 TATCAGGTAGAAAAGAAACCAGG - Intronic
1159616348 18:70584385-70584407 TCTCACATAGCTCAGAGAGCTGG - Intergenic
1159665629 18:71156712-71156734 TATTACATAGCAGTGAAGCCTGG + Intergenic
1166251533 19:41574745-41574767 TATAAAATAGCACAGCAAACTGG + Intronic
925696484 2:6585608-6585630 TATGACTAAGGACAGAAACCGGG + Intergenic
926875747 2:17476648-17476670 TATCAAATAACACAGAAATTTGG + Intergenic
930882300 2:56285653-56285675 TATGACATAACACAAAAGCCAGG - Intronic
935768044 2:106389035-106389057 TATCCCACAGCAAAGAAACAAGG - Intergenic
936852652 2:116919578-116919600 TTTAACAAAGCACAGAAACAGGG + Intergenic
936909807 2:117579064-117579086 TATTACAGAGCACAGAAAAAAGG + Intergenic
940899170 2:159110609-159110631 TTTCACATACCACAGAAGGCTGG - Intronic
941310081 2:163917002-163917024 TATATCATAGCCCTGAAACCTGG + Intergenic
942877812 2:180823452-180823474 TGTGAAAAAGCACAGAAACCCGG - Intergenic
943718141 2:191174597-191174619 GATGACATAGCAAAGAAACTGGG + Intergenic
948005774 2:234606473-234606495 TAAGAGATAGCACAGAAACCTGG - Intergenic
1170874947 20:20241731-20241753 TATCATATAGCACCCAAAGCTGG + Intronic
1173994927 20:47330597-47330619 TGTCAGAAAGCAAAGAAACCAGG + Intronic
1176334498 21:5583474-5583496 GATCAGGTGGCACAGAAACCTGG + Intergenic
1176393259 21:6237474-6237496 GATCAGGTGGCACAGAAACCTGG - Intergenic
1176468160 21:7078700-7078722 GATCAGGTGGCACAGAAACCTGG + Intronic
1176491721 21:7460478-7460500 GATCAGGTGGCACAGAAACCTGG + Intergenic
1176508921 21:7677905-7677927 GATCAGGTGGCACAGAAACCTGG - Intergenic
1179391854 21:41000800-41000822 GATGACATAGGTCAGAAACCAGG - Intergenic
1182793575 22:32973678-32973700 TGATACTTAGCACAGAAACCTGG + Intronic
1183131272 22:35839096-35839118 TTCCACAGAGCATAGAAACCTGG + Intronic
951546485 3:23831213-23831235 TATCAGAAACAACAGAAACCAGG + Intronic
953781001 3:45870318-45870340 AATCAGATGGCACAGAAGCCTGG + Intronic
956405344 3:68923007-68923029 TTTAAAATAGCAAAGAAACCTGG + Intronic
957587206 3:82147598-82147620 GATGACACAGCACAGAAGCCAGG + Intergenic
958551869 3:95624524-95624546 TGTCATATATAACAGAAACCAGG - Intergenic
959174383 3:102887564-102887586 TATCATATTGGACAGAAATCTGG - Intergenic
961193222 3:124979928-124979950 AAATAAATAGCACAGAAACCTGG + Intronic
963646199 3:147917878-147917900 TACCATATAGCACATAAAACAGG - Intergenic
966244572 3:177792580-177792602 TGTCACATTGCACAAAAACATGG - Intergenic
966784721 3:183612735-183612757 TTTCACACAGCACAGAGCCCTGG - Intergenic
972403370 4:38725248-38725270 TATCACATAGCAGCAGAACCAGG - Intergenic
974664105 4:64935788-64935810 TATCACAGAGTGCAAAAACCTGG - Intergenic
975906502 4:79219562-79219584 TATCATATAGCACAAATAACAGG - Intergenic
977139467 4:93350002-93350024 TATCACATGCCACTGATACCTGG - Intronic
977931987 4:102759720-102759742 TACCACATAGTATAGAGACCAGG + Intronic
979039924 4:115776749-115776771 TATTACAAAGCACAGAAAAATGG - Intergenic
980867077 4:138564391-138564413 TATCACAGGGCACAGTAACAGGG + Intergenic
981206676 4:142049191-142049213 CATCATATAGCACAGAAAACAGG + Intronic
981264741 4:142769121-142769143 AACCACTTAACACAGAAACCTGG - Intronic
984768610 4:183418995-183419017 TTTCACATCGCACACAAACACGG + Intergenic
988673505 5:33407368-33407390 TATCAAATAGCACCAAAATCAGG + Intergenic
991129067 5:63100781-63100803 TATCAAATAGCACAGCAAGTAGG - Intergenic
993940656 5:94054328-94054350 TATCACAGACCACAGAGACTGGG - Intronic
994260944 5:97657995-97658017 TATAACAGAGAACAGAAACATGG + Intergenic
994382386 5:99086532-99086554 TATAACATAACTGAGAAACCAGG - Intergenic
995176565 5:109184466-109184488 TATAACCTAGCTCTGAAACCTGG - Intronic
996042341 5:118829400-118829422 TATCACACAGCATAGAAAGTAGG + Intergenic
997022618 5:130019359-130019381 CATCACCCAGCCCAGAAACCTGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000494457 5:161963122-161963144 TATTATAAAGCACAGAATCCCGG + Intergenic
1002595457 5:180318931-180318953 TATCATAGAGCACACCAACCGGG - Exonic
1002628786 5:180553812-180553834 TCTCATATAGTACAGAAAACAGG + Intronic
1004518728 6:16342526-16342548 TACCACAAAGCACTGAAAGCAGG + Intronic
1005362070 6:25040440-25040462 CAACACCTAGCACATAAACCAGG + Intronic
1008221181 6:48855294-48855316 TATCACAAATCCCAGAAACATGG - Intergenic
1009456749 6:63865873-63865895 TATCAGATAGCAGATAAAGCTGG + Intronic
1009871787 6:69461749-69461771 CATCAGATACCACAGAAAACTGG - Intergenic
1013612404 6:111807544-111807566 TAACACATGGCACAAAAAGCAGG + Intronic
1013935724 6:115590497-115590519 TATCAGATATCACAGATTCCGGG + Intergenic
1016091868 6:139989457-139989479 TGTCACATAGCAAATAAGCCAGG + Intergenic
1016182475 6:141164157-141164179 AATGACAAAGCAAAGAAACCAGG - Intergenic
1017626981 6:156358836-156358858 TAACACATCATACAGAAACCAGG - Intergenic
1018128888 6:160709215-160709237 TATCCCACAGCAAAGAAACAAGG - Intronic
1022018903 7:26379119-26379141 TATCACATAGTACAGCAATAAGG - Intergenic
1024462663 7:49674595-49674617 TATCATATAAAATAGAAACCAGG + Intergenic
1029290177 7:99496428-99496450 GGTCACATAGCACAAAGACCAGG + Intronic
1030981970 7:116196861-116196883 GATTTCAAAGCACAGAAACCTGG + Intergenic
1032458972 7:132095279-132095301 CTTCACTGAGCACAGAAACCTGG + Intergenic
1034331117 7:150282986-150283008 TCTCACCTAGCACATAACCCAGG + Intronic
1034666927 7:152826867-152826889 TCTCACCTAGCACATAACCCAGG - Intronic
1035302147 7:157904522-157904544 TCTCACAAAGCACAGAATCCGGG + Intronic
1036602418 8:10274128-10274150 TATCACAGAGCAGAGAAAGAAGG + Intronic
1039646273 8:39287165-39287187 TATGGCAAAACACAGAAACCTGG - Intergenic
1042653926 8:71073972-71073994 CACCACATAGAACAGAAAACAGG - Intergenic
1042668583 8:71234574-71234596 TATGAGCTATCACAGAAACCTGG - Intronic
1044791398 8:95850793-95850815 TATCAGAAAGCTCAGAAACCGGG - Intergenic
1045546324 8:103132129-103132151 TATCACAGAGGCCAGAAAGCAGG - Intergenic
1046190361 8:110787117-110787139 TAACACATATAACAGAAAGCTGG - Intergenic
1047641480 8:126826025-126826047 TATCAGATTGCACAGAAATGTGG - Intergenic
1050571666 9:6946569-6946591 ACTCACATATCACAGAAACTTGG - Intronic
1051336201 9:16068728-16068750 GATTACATACAACAGAAACCTGG + Intergenic
1055268626 9:74529771-74529793 TATAATTTAGGACAGAAACCAGG - Intronic
1057401986 9:94731621-94731643 TATCACATAGCACAGAAACCAGG - Intronic
1058222675 9:102321874-102321896 TATTATATAGGTCAGAAACCTGG + Intergenic
1203427134 Un_GL000195v1:51444-51466 GATCAGGTGGCACAGAAACCTGG - Intergenic
1194239371 X:91424630-91424652 AATCACATAGGTCAGAAACTTGG + Intergenic
1196285640 X:113876501-113876523 TATCACAAAGCAAAGGAAACTGG - Intergenic
1199298584 X:146186889-146186911 TAACACAAAGGTCAGAAACCTGG - Intergenic