ID: 1057403442

View in Genome Browser
Species Human (GRCh38)
Location 9:94744615-94744637
Sequence CACTTCAACCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057403437_1057403442 9 Left 1057403437 9:94744583-94744605 CCTAGCTGCTTGGGAGGCTGAGG 0: 3434
1: 102016
2: 213351
3: 348454
4: 379349
Right 1057403442 9:94744615-94744637 CACTTCAACCCAGGAGACGGAGG No data
1057403435_1057403442 17 Left 1057403435 9:94744575-94744597 CCTGTAATCCTAGCTGCTTGGGA 0: 83
1: 4231
2: 63389
3: 194941
4: 587094
Right 1057403442 9:94744615-94744637 CACTTCAACCCAGGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057403442 Original CRISPR CACTTCAACCCAGGAGACGG AGG Intronic
No off target data available for this crispr