ID: 1057405305

View in Genome Browser
Species Human (GRCh38)
Location 9:94764991-94765013
Sequence TTCTCACTTTACCATGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057405303_1057405305 4 Left 1057405303 9:94764964-94764986 CCTGAAATCTCTTTTGTAAGAGC 0: 2
1: 1
2: 1
3: 32
4: 317
Right 1057405305 9:94764991-94765013 TTCTCACTTTACCATGTGGCAGG No data
1057405301_1057405305 19 Left 1057405301 9:94764949-94764971 CCAAGTTCTTTCTACCCTGAAAT 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1057405305 9:94764991-94765013 TTCTCACTTTACCATGTGGCAGG No data
1057405302_1057405305 5 Left 1057405302 9:94764963-94764985 CCCTGAAATCTCTTTTGTAAGAG 0: 2
1: 0
2: 3
3: 56
4: 479
Right 1057405305 9:94764991-94765013 TTCTCACTTTACCATGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057405305 Original CRISPR TTCTCACTTTACCATGTGGC AGG Intronic
No off target data available for this crispr