ID: 1057407174

View in Genome Browser
Species Human (GRCh38)
Location 9:94783202-94783224
Sequence CTGAACACAAGCGCCTCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057407174_1057407177 21 Left 1057407174 9:94783202-94783224 CCTATAGAGGCGCTTGTGTTCAG 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1057407177 9:94783246-94783268 GTTCACAAGAATGATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057407174 Original CRISPR CTGAACACAAGCGCCTCTAT AGG (reversed) Intronic
900590665 1:3458057-3458079 CGGAACACCAGGGCCTCTCTGGG + Intronic
900933346 1:5750492-5750514 CTCAACACATGAGCCTCTCTGGG - Intergenic
1069894781 10:71673572-71673594 CTGAGAACAAGCGCCCCTCTTGG + Intronic
1077360744 11:2139275-2139297 CTGCCCACCAGCGCCTCCATCGG - Intronic
1086369582 11:86143026-86143048 CTGAACATAAGCCCCTCTCCAGG + Intergenic
1089740128 11:120576776-120576798 GGGAACACAGGCTCCTCTATGGG - Intronic
1095085106 12:38051738-38051760 GTGAACACAAGTGCCTCTGCTGG - Intergenic
1111200412 13:84928211-84928233 CTATACACAAGCGACTCTACTGG + Intergenic
1119745301 14:77039687-77039709 CAGAGCACAAGGGCTTCTATGGG - Intergenic
1119761745 14:77156595-77156617 CTGCAGATAAGAGCCTCTATAGG + Intronic
1129931484 15:79414750-79414772 CTGAACCCAAGTGCCCCTCTAGG - Intronic
1136423380 16:30151811-30151833 CTGAACACAAGGGCCTTGCTGGG - Intergenic
1143038486 17:4015234-4015256 CTGACCACATGTGCCTGTATGGG + Intronic
1143785290 17:9251128-9251150 ATCAAAACAAGCACCTCTATCGG - Intronic
1144641136 17:16937462-16937484 CTGAACCCAAGGGGCTCTGTAGG - Intronic
1144873881 17:18386761-18386783 TTGAACCCAAGGGGCTCTATAGG + Intronic
1145158590 17:20559025-20559047 CTGAACCCAAGGGGCTCTATAGG - Intergenic
1148528119 17:48362281-48362303 CTTAACACAAGAGACTATATGGG - Intronic
927994312 2:27472265-27472287 CTGGACACAAGCTCCTCTTCAGG - Exonic
932989514 2:76769408-76769430 GTGAACACAAACTTCTCTATTGG + Intronic
936044930 2:109180076-109180098 CTGAACAAATGGGCCTCCATGGG + Intronic
938458863 2:131484858-131484880 CTGAACACCAGAGGCTCTCTCGG + Intronic
1170725871 20:18926029-18926051 CTGAAAACAAGTCCCCCTATGGG - Intergenic
1171393846 20:24818232-24818254 CTGAACCCAAGGGCCTTTAAAGG - Intergenic
1175752419 20:61508584-61508606 CTGAACACATGCCCCTGTCTTGG - Intronic
1176512636 21:7760013-7760035 CTAAACACAAGCGCTTTTCTAGG + Intronic
1178202054 21:30418581-30418603 CTGAACACAAGAGACCCTAATGG + Intronic
1178646749 21:34390537-34390559 CTAAACACAAGCGCTTTTCTAGG + Intronic
1179779970 21:43693256-43693278 CTGAACAGAAGCCCCTCCACGGG + Exonic
988941221 5:36150210-36150232 GTGAACACAAGATCCTCTCTAGG - Intronic
1001461120 5:171915490-171915512 CTGAACACTAGCTGCTCTACAGG + Intronic
1020179099 7:5907491-5907513 CAGAACACAAGCCCCGCCATGGG + Intronic
1020303834 7:6817378-6817400 CAGAACACAAGCCCCGCCATGGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1033560918 7:142529552-142529574 CTGAACACAACCGCCTTTATTGG + Intergenic
1035785335 8:2255321-2255343 CCCACCACAAGCTCCTCTATGGG + Intergenic
1035807473 8:2466395-2466417 CCCACCACAAGCTCCTCTATGGG - Intergenic
1046720870 8:117617542-117617564 ATGACCACAAGCCCCACTATAGG - Intergenic
1046761693 8:118028108-118028130 CTCAACACAAGGGCCTTTAGGGG - Intronic
1056100425 9:83295678-83295700 CCGAACACAAGCACCTGTGTAGG - Intronic
1057407174 9:94783202-94783224 CTGAACACAAGCGCCTCTATAGG - Intronic
1057991544 9:99775972-99775994 CTGAACACACGTGGCTTTATGGG - Intergenic
1061956121 9:133962128-133962150 CTGCCCACCAGCTCCTCTATGGG + Intronic
1192938346 X:75885058-75885080 CTGCACACAAACACTTCTATGGG - Intergenic
1193550542 X:82887141-82887163 ATGAGCTCAAGCCCCTCTATAGG - Intergenic
1202096915 Y:21260776-21260798 CTGAACACAAGTGCCAATGTAGG + Intergenic