ID: 1057407725

View in Genome Browser
Species Human (GRCh38)
Location 9:94788820-94788842
Sequence CTGTGGTGCTGGAGGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057407725_1057407728 -8 Left 1057407725 9:94788820-94788842 CCATTTCTCCTCCAGCACCACAG 0: 1
1: 1
2: 2
3: 51
4: 491
Right 1057407728 9:94788835-94788857 CACCACAGCTGCCAGTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057407725 Original CRISPR CTGTGGTGCTGGAGGAGAAA TGG (reversed) Intronic
900295480 1:1947047-1947069 CTCTGGTTCTGGAAGAGAAGGGG + Exonic
900417852 1:2543268-2543290 CCGTGGTGAGGGAGGAGGAACGG + Intergenic
900792926 1:4691571-4691593 CCCTGGTGCTGGAGGAGAGTCGG + Intronic
901185313 1:7369081-7369103 CTGTGGTGGGGGAGGAGGAGGGG - Intronic
901215989 1:7555691-7555713 CCTTGGTGCTGGGGGAGACAGGG - Intronic
901238865 1:7681466-7681488 CTTTGTGGGTGGAGGAGAAATGG - Intronic
901540283 1:9910736-9910758 CTGTGCTCCTGGAGCAGATAGGG - Intergenic
901568726 1:10141683-10141705 CTGTGGTTCTGGAAGCGAAGAGG + Intronic
901671950 1:10861225-10861247 TTGAGGTGCAGGAAGAGAAAAGG + Intergenic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901839415 1:11944705-11944727 CTGCGGTGCTGGGGGAGGAGGGG - Intronic
902368229 1:15990810-15990832 CTGTGGGGCCGGAGGAGCCAGGG + Intergenic
902812332 1:18895577-18895599 ATCTGGTGCAGGAGGTGAAATGG - Intronic
903301296 1:22380437-22380459 CTGTGGTGGGGGTGGAGGAAGGG - Intergenic
903542957 1:24107181-24107203 CCGTGGAGCTGGAGGAGCGAGGG - Exonic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905450006 1:38050110-38050132 AGGTGGTGCTGCAGGACAAAGGG - Intergenic
907290957 1:53412575-53412597 CTCTGGTGATGCAGCAGAAACGG - Intergenic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907476422 1:54708898-54708920 GTGTGGGGCTGGAGGATAATGGG + Intronic
909033896 1:70574669-70574691 CTGAGGGGCTGGAGTAGAAAGGG - Intergenic
909953642 1:81750769-81750791 CTGTGGTGCTGGTTTGGAAATGG + Intronic
911733092 1:101309956-101309978 CAGGGAAGCTGGAGGAGAAACGG - Intergenic
911770566 1:101735659-101735681 CAGTGCTGCTGGAGCATAAAGGG + Intergenic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
912891456 1:113536869-113536891 CAGTGGTAGTGAAGGAGAAAAGG - Intronic
914461507 1:147889997-147890019 TTGTGGTGCTGTGGGAGACAGGG + Intergenic
915304319 1:154969117-154969139 AGGTGGAGCTGGAGTAGAAAAGG - Intronic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
915915644 1:159938953-159938975 TGGTGGTGCAGGAAGAGAAAAGG - Intronic
916193563 1:162202000-162202022 CTATGGGGGTGGTGGAGAAACGG + Intronic
916316115 1:163449846-163449868 GTGTGGTGGTGGTGAAGAAATGG + Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918146261 1:181758624-181758646 GTGTGGTACAGGAGGAGAGATGG - Intronic
918549441 1:185724424-185724446 CTTTGGTGATGGAGTAGAATTGG - Intergenic
918660156 1:187078328-187078350 TAGTGGTGATGGAGAAGAAAAGG + Intergenic
919352070 1:196470454-196470476 CTGTGTAGCTGAAGGTGAAATGG + Intronic
919588953 1:199475282-199475304 CTTTCCTGCTGGTGGAGAAAAGG - Intergenic
920097484 1:203496037-203496059 CCTTGGTGCTGCAGGAGACAGGG + Exonic
920877908 1:209854588-209854610 CTATGCTGCTGAAGGAGGAAAGG + Exonic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
1063045664 10:2390042-2390064 ACATGGTGCTGGAGGTGAAATGG - Intergenic
1064707287 10:18086205-18086227 CTGTGGTGTTGGAGCAGGAATGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065814801 10:29473847-29473869 CGGTGGAGCTGGACGAGGAAAGG - Exonic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069211553 10:65767588-65767610 CTTTGGTGTTGGAGGATAAAAGG + Intergenic
1069277606 10:66612120-66612142 TTGTGATGATGGAGGTGAAAGGG - Intronic
1070727606 10:78803013-78803035 GCGTTGTGCTGGAGGAGGAAGGG + Intergenic
1072204419 10:93190080-93190102 ATGGGGTGCTGGGGGAGAATAGG - Intergenic
1073065940 10:100759236-100759258 CAGAGGTGATGAAGGAGAAAGGG + Intronic
1073511875 10:104047534-104047556 CTGAGCTGCTGGAGGAAAACGGG + Intronic
1073636154 10:105200847-105200869 CTATGGAGGTGGAGCAGAAACGG + Intronic
1073927955 10:108538879-108538901 TTGTGGTGCTGGTAGAGACAAGG - Intergenic
1074390088 10:113049862-113049884 TTGTGCTGGTGGAGGAGAGATGG + Intronic
1074546839 10:114407983-114408005 CTCTGTTGCTGTAGCAGAAAGGG + Intergenic
1075763655 10:124875911-124875933 CTCTGGCACTGGAGGAGAAAGGG - Intergenic
1075797939 10:125134626-125134648 CTGTGGTGCGGGGGCAGAAAAGG - Intronic
1075838016 10:125472923-125472945 ATGGGGTCCTGGAGCAGAAAAGG - Intergenic
1076847420 10:133076152-133076174 CTGTGATGCTGGGGGAGTGAGGG - Intronic
1077069763 11:663490-663512 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069780 11:663603-663625 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069789 11:663660-663682 CTGAGGAGTTGGAGGAGGAAAGG - Intronic
1077150936 11:1072910-1072932 CTGTGGTGGTGGAGGCGATGGGG - Intergenic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1077782993 11:5352182-5352204 CATTGGTTCTGGAGGAGAAAGGG + Exonic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080489578 11:32748843-32748865 TTATGGTGCTGAAGGAAAAAAGG - Intronic
1081174828 11:39914313-39914335 ATGTGGTGCAGGAGTAGCAAGGG + Intergenic
1081338664 11:41900639-41900661 GTGTGGTGAGGAAGGAGAAATGG + Intergenic
1081401009 11:42642866-42642888 CTGTGCAACTGAAGGAGAAAAGG + Intergenic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081496184 11:43612860-43612882 CTGTGGAACTGGGTGAGAAATGG + Intronic
1081685795 11:45042180-45042202 GTGGTGTGCTAGAGGAGAAAGGG - Intergenic
1081693223 11:45092348-45092370 CTGGGGTCCTGGAGGAGTCAGGG - Intergenic
1081921904 11:46786264-46786286 CTGTGGAGCTGGAAGAAAAGGGG - Intronic
1082757912 11:57096390-57096412 GTGGGGTGGTGGAGGAGAGATGG + Intergenic
1083088090 11:60170697-60170719 CTGTGGTGGTGGTGAAGACATGG + Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083417248 11:62533712-62533734 CTCTGGTCCTGAAGCAGAAATGG + Exonic
1083736676 11:64685512-64685534 GTGTGGTTCTGGAGAAGAACAGG - Intronic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1084116068 11:67043623-67043645 CTCTGGATCTGCAGGAGAAAAGG - Exonic
1084554171 11:69865853-69865875 CGGAGGTGCAGCAGGAGAAATGG + Intergenic
1085450651 11:76630131-76630153 CTGGGGTCCTGGAGAAGACAAGG - Intergenic
1086922344 11:92601767-92601789 CTCTGGTGCAGAAGGACAAACGG - Intronic
1087031968 11:93715250-93715272 CTGTGGTGGTGGTGGACAAGGGG - Intronic
1087500593 11:98948137-98948159 CTGTTTTTTTGGAGGAGAAATGG - Intergenic
1087886045 11:103484096-103484118 CTGTGGTGGTAGGGGAGAATGGG - Intergenic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1089119309 11:116122350-116122372 GTCAGGGGCTGGAGGAGAAAGGG + Intergenic
1089324529 11:117648118-117648140 AGATGGTGCTGGTGGAGAAAGGG - Intronic
1089624767 11:119744301-119744323 CAGTGGTGATGAAGAAGAAAGGG - Intergenic
1090381339 11:126329622-126329644 CTGTGGTGTTGCAGGAGCACTGG + Intronic
1091354432 11:134924729-134924751 ATGAGATGCTGGAGGAGGAAAGG - Intergenic
1091422914 12:359159-359181 CTGTGGTGCTGGATTAGAGCTGG + Intronic
1091630502 12:2156799-2156821 CATTGCTGCTGGGGGAGAAATGG - Intronic
1091903404 12:4163981-4164003 CTGTGGAGCTGAAGGAGACAAGG + Intergenic
1092173110 12:6385391-6385413 CTGAGGGGCTGGATGTGAAAAGG + Intronic
1092501539 12:9052332-9052354 CTATGCTGAGGGAGGAGAAAAGG - Intergenic
1093176395 12:15918040-15918062 CTGTGGTGTTGGACCAGAACTGG - Intronic
1093588564 12:20872152-20872174 CTGTGGTGGTGGTGGACACAGGG - Intronic
1094766117 12:33596553-33596575 CTGCGGTTGGGGAGGAGAAAGGG + Intergenic
1095734870 12:45545829-45545851 ATGTGGTGCTGGAGGGGTATTGG + Intergenic
1096424223 12:51487561-51487583 AAGTGGTGCTAGAGGATAAAAGG - Intronic
1096843687 12:54393633-54393655 CTGTGTTGGTGGAGATGAAAAGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097100790 12:56587637-56587659 CTGTGCTGCTGAGGGAGAGATGG - Exonic
1097250439 12:57629786-57629808 CTCTTTTGCTGGAAGAGAAATGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097264914 12:57739010-57739032 CATCGGTGCTGGTGGAGAAAAGG - Intronic
1097275151 12:57808072-57808094 CTGAGGTGCCGGAGGGGAAAGGG + Intronic
1097459001 12:59836699-59836721 TCCTGGGGCTGGAGGAGAAAAGG - Intergenic
1099088162 12:78272975-78272997 CTGTAGAGGTTGAGGAGAAAAGG - Intergenic
1099094788 12:78360623-78360645 TTATAGTGCTGGAGGAGAGAAGG - Intergenic
1099472991 12:83074361-83074383 CTGTTCTGGTGGAGGTGAAATGG + Intronic
1101927648 12:108985858-108985880 CTGTTGTGCTGGCATAGAAAGGG + Intronic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103881018 12:124166107-124166129 CTTTGACCCTGGAGGAGAAAAGG - Intronic
1104666462 12:130650538-130650560 ATGTGCTGCTGGAGGGGACACGG - Intronic
1105471474 13:20698808-20698830 CTGAGGTGCTGTGGGACAAAGGG + Intergenic
1107580651 13:41780568-41780590 CTGTGGGGATGGAAAAGAAAGGG - Intronic
1108589184 13:51897050-51897072 CTGTGGTGCCAGAGAACAAAGGG - Intergenic
1110324099 13:74194195-74194217 CTGGGGTGGTGGTGGTGAAAAGG + Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1111865126 13:93758723-93758745 CTATGGTGTTTGAAGAGAAAGGG - Intronic
1111988466 13:95090185-95090207 CTGTGGTAGTGGAAGACAAAGGG + Intronic
1112183364 13:97106217-97106239 GGGTGGTGCCGGAGGAGAAGAGG + Intergenic
1112289745 13:98135036-98135058 CTGGGGAGTTGGAGGAGAATGGG - Intergenic
1113058830 13:106299201-106299223 ATGTGGTGCTGGATGGGCAAAGG - Intergenic
1114055696 14:18965637-18965659 CTTTGGTGTGGGAGGAAAAATGG - Intergenic
1114057788 14:18988943-18988965 CTGTGTTGCTGCAAGGGAAATGG + Intronic
1114104759 14:19412810-19412832 CTGTGTTGCTGCAAGGGAAATGG - Intronic
1114106851 14:19436127-19436149 CTTTGGTGTGGGAGGAAAAATGG + Intergenic
1114152860 14:20064305-20064327 CTCTGGTGCTGCAGCAGAGAAGG - Intergenic
1114472575 14:22974009-22974031 CAGCGGTGCTGGAGAAGAAGTGG - Intronic
1114683856 14:24509133-24509155 CTCTAGTGCTAGAGCAGAAAGGG - Intergenic
1114695937 14:24627845-24627867 CTGTGGCCCTGGAGGAAAAGAGG + Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1117342227 14:54802347-54802369 CTGAGGTGCTGGGGAAGAATTGG + Intergenic
1117756465 14:58979397-58979419 ATGTGGGGCTGCAGGAGGAAGGG + Intergenic
1118158649 14:63266893-63266915 CTGTGGAGCTGGATCAGAAAAGG - Intronic
1118168843 14:63364971-63364993 CTGTGGTGCTGGATTAGAGTTGG + Intergenic
1118839779 14:69501603-69501625 TTGAGATTCTGGAGGAGAAAGGG + Intronic
1118865656 14:69701654-69701676 CTCTGGTGGTGGAGGAGAATAGG + Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119739814 14:77007086-77007108 TTGTGGGGCTGCAGGAGCAAGGG + Intergenic
1121475015 14:94191209-94191231 CTGTGGGGTGTGAGGAGAAAGGG + Intronic
1121901981 14:97701599-97701621 CTGGGGTGAGGGTGGAGAAATGG + Intergenic
1122602858 14:102930003-102930025 AGGTGGTGCTGGTGGAGAATGGG + Exonic
1122746670 14:103901168-103901190 CTGCGCTGCTGGAGGAAAAGTGG - Intergenic
1122806355 14:104261603-104261625 CTGTGCTGCTGGGGGAGGCAGGG + Intergenic
1124813553 15:32965968-32965990 CTGTGGTGCTGGGGGAGACGGGG + Intronic
1124899268 15:33807429-33807451 CTGTTGTGTTGGCTGAGAAATGG + Intronic
1125889988 15:43258710-43258732 CTGTGGTGCTGCAGGACAGGAGG - Intronic
1125934806 15:43625911-43625933 GTGTAGTGTTGGAGGAAAAAAGG + Intergenic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1126585032 15:50276743-50276765 ATGTGGTGCTGGAGCAGAGAAGG - Intronic
1126601965 15:50437816-50437838 CTGTAGTGATAGGGGAGAAAAGG - Intronic
1127394956 15:58537241-58537263 CTGTGGTGCTGCACCAGAGACGG - Intronic
1127582830 15:60353337-60353359 CTGTTGTGGTGGGGGAGAAAGGG - Intronic
1127891015 15:63250995-63251017 AAGTGGTGGTGGAGGAGGAAGGG - Intronic
1128613975 15:69095194-69095216 ATGTGGTGCAGGTGGAGAAGAGG - Intergenic
1129309606 15:74696785-74696807 CTCTGGTGATGGAGGGGGAAGGG - Intergenic
1129708394 15:77807603-77807625 CTGTGGTCCTGGGAGAGAAATGG - Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130758770 15:86795527-86795549 CTGAGGGGCTGGATGAGGAAGGG - Intronic
1130892493 15:88145020-88145042 TTTTGGCCCTGGAGGAGAAAGGG - Intronic
1131048144 15:89329111-89329133 CTGAGGAGGAGGAGGAGAAAAGG + Intronic
1131093717 15:89642519-89642541 CTGTGGTACTGGTGGTGCAAAGG - Intronic
1131781613 15:95865818-95865840 CAGGGCTGCTGCAGGAGAAAGGG - Intergenic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132912143 16:2319590-2319612 CTGTCGTGCAGGAGAAGGAAAGG - Exonic
1134211638 16:12282349-12282371 CTTTGTTACTGGAGAAGAAAGGG + Intronic
1134610856 16:15606842-15606864 CTGTGGGGCTGAGGGAGCAAGGG - Intronic
1135232412 16:20721530-20721552 CTGTAGTGCTGGAGCAGAGTAGG + Intronic
1136428478 16:30184149-30184171 CTGTGGTGGGGGAGGAGGCAGGG + Intronic
1136554688 16:31001051-31001073 CTGTGGGGTGGGAGGAGAAGGGG - Intronic
1137238870 16:46638027-46638049 GTGTGGTGCTGGAGGATGATGGG - Intergenic
1137393782 16:48102778-48102800 GTGTGGTGCAGGAGGAGAAGCGG - Intronic
1137934052 16:52616967-52616989 CAGTGGTGCTGGAGAACATATGG - Intergenic
1138354603 16:56367198-56367220 CTCATGTGCTGGAAGAGAAAGGG - Intronic
1138756922 16:59498408-59498430 CTGTGGTGCTGGATTAGAACTGG - Intergenic
1138853117 16:60654343-60654365 CTTTGTTGGTGGAGAAGAAAAGG - Intergenic
1139751900 16:69114038-69114060 CTGTGGTGGTGGCAGAGAAGGGG - Intronic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1140712677 16:77693140-77693162 CCATGGTGCTGGTGGAGGAAGGG - Intergenic
1141768546 16:86074711-86074733 CTGGGGTGCTGGAGGTGACTGGG + Intergenic
1143205336 17:5136778-5136800 CTGTGGGGCTGTAGGAGCAGGGG + Intronic
1143551142 17:7631225-7631247 CTGTGCTGCTGGAGGTGGATGGG + Exonic
1143599465 17:7934704-7934726 CTGTGTTCCTGAAGGAGTAAAGG - Intronic
1143801497 17:9386413-9386435 CTGGGGTGCTTGACTAGAAAGGG + Intronic
1144086395 17:11812749-11812771 TTGTGGCATTGGAGGAGAAAAGG - Intronic
1144447422 17:15343987-15344009 CTTTAGTGCTGGAGGAGAAATGG - Intergenic
1144455001 17:15411695-15411717 CTTTGGAGCAGGAGGAGAGAAGG + Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1146500350 17:33359026-33359048 CATTGTTGCTGGAAGAGAAAGGG - Intronic
1147419608 17:40315956-40315978 CTCTGATGCAGGAGGAGAGAAGG - Intronic
1147524445 17:41207521-41207543 GTGTGGTATTGGAGGAGGAATGG - Intronic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148103226 17:45105368-45105390 CTGTGGCACTGGGGGAGGAAGGG - Intronic
1148442747 17:47720283-47720305 CTGTGATGCTAGAGAAGAAAGGG + Intergenic
1148823505 17:50375369-50375391 CTCTGGTGCTGGAGGACAGGAGG - Exonic
1148865149 17:50624428-50624450 CTGTGGGGCTGGAGCAGATGAGG - Exonic
1149722057 17:58855145-58855167 CTGTGCTTCTGGAAGGGAAAGGG + Intronic
1151371466 17:73648797-73648819 CTGTGTTGAAGGTGGAGAAAGGG + Intergenic
1151781946 17:76252559-76252581 CTGTGTTTCTGAAGGAGAAGGGG + Intergenic
1152080604 17:78185161-78185183 CTGTGCTGCAAGAGGAGAGAGGG + Exonic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1153234980 18:2977270-2977292 CTGTGGTGCTGGACTGGAATTGG + Intronic
1153571353 18:6476400-6476422 CTCTTGTGCTGCAGGAGATAAGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1155180521 18:23341522-23341544 CAGTGGTGCCAGAGGAGAATCGG - Intronic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156396619 18:36705103-36705125 CTGTGATGCAGGTGGAGACAGGG + Intronic
1157475251 18:48019872-48019894 ATGTGGTGATGGGGGAGAGATGG + Intergenic
1160051737 18:75440054-75440076 GTGTTCTGCTGGAGGAGTAATGG + Intergenic
1160119281 18:76113163-76113185 GTGGGGTGCTGCAGGAGAACGGG + Intergenic
1160131815 18:76231912-76231934 CTATGCTGCTGGAGTCGAAAGGG + Intergenic
1160508032 18:79438074-79438096 CTGTGGTCCCGGAGGAGACCTGG + Intronic
1160856435 19:1220045-1220067 CTGTGGTCCTGCAGCAGCAAGGG - Intronic
1162827058 19:13259504-13259526 CTGGGGAGCAGGAGGATAAAGGG - Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163640758 19:18460807-18460829 CTGTGGTGGAGGAAGAGACATGG - Intronic
1164188261 19:22891989-22892011 CTGTGGTGCTGGACCAGATTTGG - Intergenic
1164618889 19:29682163-29682185 CTGTGCTGCTGCGGGAGACAGGG - Intergenic
1165277826 19:34770328-34770350 CTGTGGTGATGGAGGAGTACAGG - Intronic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1165447518 19:35864676-35864698 ATCTGGTTCTGGAGGAGGAAGGG + Exonic
1166408273 19:42539411-42539433 CAGTGGTGGTGCTGGAGAAAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167773891 19:51542488-51542510 CTCTGGTGCTGGAGAACAAGGGG - Intergenic
925273580 2:2633124-2633146 CTGTGGGGCTGTAGGAAAAGCGG + Intergenic
926287723 2:11503192-11503214 CTGGGATGAGGGAGGAGAAAAGG - Intergenic
926394975 2:12431612-12431634 GTGTGGTACTGGAGGAGTACTGG + Intergenic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
927096903 2:19754304-19754326 CCATGGTGCTGGAGTGGAAATGG + Intergenic
927208881 2:20626744-20626766 TTGTGGTGCTGGAGGTGAGGTGG + Intronic
927653478 2:24926733-24926755 CTGTTGTGCGGGTGGAGAAGCGG + Intergenic
928081937 2:28319610-28319632 CAGTGTTGCTGAAGGAGACAGGG - Intronic
928609037 2:32973724-32973746 GTGAGGGGCTGGAGGAGAAGTGG - Intronic
928656296 2:33455041-33455063 ATGTGGTGATGGAGGAGAGTGGG + Intronic
928656627 2:33458715-33458737 CAATGGTGCTGGTGGAAAAAGGG - Intronic
929671656 2:43880729-43880751 CTGTGATGCTGGATTGGAAATGG - Intergenic
929913664 2:46115507-46115529 CTGAGGAGCTTGAAGAGAAATGG - Intronic
930579205 2:53189463-53189485 CTGTAAAGCTAGAGGAGAAAGGG - Intergenic
931152523 2:59590383-59590405 CAGTAAAGCTGGAGGAGAAAAGG - Intergenic
931152659 2:59592212-59592234 CAGTAAAGCTGGAGGAGAAAAGG - Intergenic
931297161 2:60938567-60938589 CAGTGCTGCTGGAGGTGTAATGG - Intergenic
933088516 2:78088750-78088772 CTGGGAAGCTGGAGGAGAAGGGG + Intergenic
933572507 2:84029957-84029979 CTGTGATCCTGGAAGAGCAAGGG + Intergenic
934526954 2:95057911-95057933 CTGGGGCGCTGGAGCAGACACGG + Intergenic
935027924 2:99295146-99295168 CTTTGCAGCTGGAGGAAAAAGGG - Intronic
935209961 2:100931057-100931079 CTGTGGTGCTGGCTGAGGCAAGG - Intronic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936594324 2:113833353-113833375 CTGAGTTGCTGGAAGAGAGAGGG - Intergenic
938283421 2:130085250-130085272 CCGTGTTGCTGCAGGGGAAATGG - Intronic
938284527 2:130098907-130098929 CTGTGTTGCTGCAAAAGAAATGG - Intronic
938334053 2:130473815-130473837 CCGTGTTGCTGCAGGGGAAATGG - Intronic
938335166 2:130487470-130487492 CTGTGTTGCTGCAAAAGAAATGG - Intronic
938354659 2:130633196-130633218 CTGTGTTGCTGCAAAAGAAATGG + Intronic
938355767 2:130646852-130646874 CCGTGTTGCTGCAGGGGAAATGG + Intronic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938431080 2:131239984-131240006 CTGTGTTGCTGCAAAAGAAATGG + Intronic
938432188 2:131253641-131253663 CCGTGTTGCTGCAGGGGAAATGG + Intronic
938473866 2:131590237-131590259 CTTTGGTGTGGGAGGAAAAATGG - Intergenic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
939175215 2:138740171-138740193 CTATGATGATGGAGTAGAAAAGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
941207373 2:162590724-162590746 CTAGGGTAATGGAGGAGAAATGG - Intronic
941484520 2:166062941-166062963 AGTTGGTGGTGGAGGAGAAAAGG + Intronic
942861018 2:180612205-180612227 ATGTGCTTCTGGAGGAGACAGGG + Intergenic
943117624 2:183692504-183692526 CACTGGTGAGGGAGGAGAAAGGG + Intergenic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
944987469 2:205193831-205193853 CTGTGACACTGGAGGGGAAAAGG + Intronic
945154915 2:206828397-206828419 CTGCGGTGGTGGTGGGGAAAGGG - Intergenic
945671606 2:212809024-212809046 ATGTGGTGCTGGAGTAGTCATGG - Intergenic
946519973 2:220453821-220453843 CTGTGCTGATGTAGGGGAAAGGG + Intergenic
946908598 2:224439245-224439267 GTGTGGTGGTGGTGGGGAAAAGG - Intergenic
947067110 2:226240149-226240171 CTGGGGAGCTGGGGGAGAATGGG - Intergenic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947457024 2:230264860-230264882 CTGTTCTGCTGGAGGTGAAGGGG + Intronic
947639163 2:231696642-231696664 CTGTGGTGCGTGAGGGGACAGGG + Intergenic
947731707 2:232434976-232434998 CTGTGGTGTTGGGGGAGATGAGG - Intergenic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1171569204 20:26231866-26231888 CTTTTGTGATGTAGGAGAAAGGG - Intergenic
1172189596 20:33053944-33053966 TTGTGGAGCTGCAGGAGCAAGGG + Intergenic
1172315953 20:33954620-33954642 GTGAGGTGCTGGAAGAGACAGGG - Intergenic
1173742757 20:45413004-45413026 CTGTGGTTCGGCAGGAGAAAAGG - Intergenic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175883556 20:62274534-62274556 CTGTGGTTCTGAAGGAGGGAGGG + Intronic
1176082676 20:63281866-63281888 CTGTGGTGTTACAGGAGAAGGGG + Intronic
1178319685 21:31595941-31595963 CTTTGGGGATGGAAGAGAAAAGG + Intergenic
1179182922 21:39061070-39061092 TGGGGGTGCTGGAGGGGAAATGG - Intergenic
1179465207 21:41567350-41567372 CTGTTTTGCTGGAGAAGCAAAGG - Intergenic
1180216645 21:46327825-46327847 GTGTGTTGCTGGAGGAGACTGGG + Intronic
1180225431 21:46389199-46389221 CTCCGGCGCTGGAGGAGACATGG + Exonic
1180225527 21:46389900-46389922 CTCTGGCGCTGGAGGAGATGTGG + Intronic
1180227557 21:46404494-46404516 CCCTGGTGCTGGGGGAGAAGGGG + Intronic
1180474174 22:15688188-15688210 CTTTGGTGTGGGAGGAAAAATGG - Intergenic
1180476272 22:15711555-15711577 CTGTGTTGCTGCAAGGGAAATGG + Intronic
1181112443 22:20610020-20610042 CTGTGGAGGTGGATGAGAATAGG - Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1182083092 22:27543078-27543100 CTGTGGTGCAGCTGGGGAAATGG - Intergenic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182372148 22:29818907-29818929 CTGGGCTGCTGGGGAAGAAAAGG - Intronic
1182474827 22:30571329-30571351 ATGGGGTGCTGGAGCAGAGAGGG + Intronic
1182623875 22:31632091-31632113 CTGTAGGGCTTGCGGAGAAATGG + Intronic
1184231146 22:43159133-43159155 CGGGGATGCTGGAGGAGACACGG + Intronic
1184235469 22:43180775-43180797 CCCTGGTGCTGGAGGAGATGTGG - Exonic
1184292292 22:43503892-43503914 GCGTGGTGCTGGGGGAGGAAGGG - Intronic
1184473460 22:44708514-44708536 CGGTGTTGCTGGGGGAGACACGG - Intronic
1184758707 22:46532918-46532940 CTCTGGGGCTGGAGGTGAACAGG - Intronic
1185131311 22:49040725-49040747 ATGAGGTGCTGTGGGAGAAAGGG + Intergenic
1185311508 22:50158258-50158280 CTGTGGAGCTGCAGGAGCCAAGG - Intronic
1203238936 22_KI270732v1_random:34449-34471 CTTTCGTGATGTAGGAGAAAGGG + Intergenic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950771867 3:15318240-15318262 CTAAGGGGCTGGAGGAGGAAAGG + Intronic
952210185 3:31222471-31222493 CTGTGGTGCAGAAGGAGGGAGGG - Intergenic
952273888 3:31858681-31858703 CTGTGATGCTGCAGGATTAAAGG - Intronic
954600389 3:51863120-51863142 CGAGGGTGCTGGAGAAGAAACGG + Exonic
954748332 3:52799573-52799595 TTGTGGTGAATGAGGAGAAAGGG + Intronic
954976406 3:54699278-54699300 ATGGGATGCTGGAGGAGCAAGGG + Intronic
955525841 3:59818770-59818792 CTGCGCTGTTGAAGGAGAAATGG - Intronic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
958183868 3:90093894-90093916 CTGTATTGTTGGAGGAGAAAAGG - Intergenic
959791053 3:110361912-110361934 CTCTTCTGCTGGAAGAGAAATGG - Intergenic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
963015958 3:140824013-140824035 CTGAGTAGATGGAGGAGAAAGGG - Intergenic
963051134 3:141144965-141144987 GGGTGTTGCTGGAGGAGAGATGG + Intronic
963828075 3:149977058-149977080 TTGTGGAGCAGGAGGGGAAAGGG + Intronic
966824619 3:183953242-183953264 TTGTGCAGCTGGAAGAGAAAGGG - Exonic
967009026 3:185414066-185414088 CTCTGGTGCTGGAGTGGAACTGG + Intronic
967068826 3:185944205-185944227 ATGTGGAGGTGAAGGAGAAACGG + Intergenic
967203938 3:187102107-187102129 GTGTGGTGGGGGAGGAGAAATGG + Intergenic
968065072 3:195753979-195754001 GTGTGGGGCTGAAGGAGAAGAGG - Intronic
968925142 4:3543137-3543159 CTCTGGTGATGGTGGAGCAAAGG + Intergenic
969308569 4:6339378-6339400 GTGAGGGGCTGGAGCAGAAACGG - Intronic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
972469605 4:39391210-39391232 CTGTGGTGATGGAGGCTGAAGGG - Intergenic
973133390 4:46676142-46676164 CTGTGGGACAAGAGGAGAAATGG - Intergenic
976329504 4:83813203-83813225 CTTTTTTGCTGGTGGAGAAAAGG + Intergenic
976451814 4:85199396-85199418 CTGTGGTGGTGGTGGATACAGGG - Intergenic
976930302 4:90559321-90559343 CTGTGGTGTAGAAGGGGAAAAGG + Intronic
978634379 4:110786309-110786331 TTGGAATGCTGGAGGAGAAAAGG - Intergenic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979168640 4:117570660-117570682 TTGTGGTGCTAGATGAGGAAGGG - Intergenic
979210974 4:118102359-118102381 CTGTGGTCATGGAGGAGGTAAGG - Intronic
980429456 4:132673292-132673314 CTGTGGTACTGTAGAAGAAAGGG + Intergenic
980916106 4:139034575-139034597 TTGTGGTGGTGGTGGTGAAAGGG + Intronic
982132475 4:152243038-152243060 CTGTGCTGCTGGTGGAGATACGG - Intergenic
984724713 4:183009668-183009690 CTAAGGAGCTGGAGGACAAAAGG + Intergenic
985021973 4:185701378-185701400 CTGTGGACCTGAAGGAGAACAGG - Intronic
985091323 4:186365110-186365132 ACGTGGTGATGGAGGAGAGAGGG - Intergenic
986025258 5:3844679-3844701 CTGTGCTTCTGGAGTGGAAAGGG - Intergenic
986300589 5:6475710-6475732 GGGTGGTGCTGGAGGAGGCAGGG + Intronic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
986599410 5:9456626-9456648 CAAAGGGGCTGGAGGAGAAAAGG + Intronic
987817634 5:22923587-22923609 CTTTGGTGCTGGAGATAAAAGGG - Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988613722 5:32752757-32752779 CTGAGGTGTTGCAGGAGGAATGG + Intronic
989277795 5:39610033-39610055 CTTTGCTGCTGGAGCAGAGAAGG + Intergenic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
990276821 5:54205985-54206007 TTCTGGGGGTGGAGGAGAAAGGG - Intronic
990899999 5:60739544-60739566 CTGTGGTGGTGGTGGACACAGGG + Intergenic
991638891 5:68733873-68733895 CTCAGGTCATGGAGGAGAAATGG - Intergenic
993228677 5:85204096-85204118 CTACTGTGCTGGAGGAGCAAAGG + Intergenic
994193573 5:96897011-96897033 GTGTGGTGTTAGAGGAAAAAGGG - Intronic
995101352 5:108311040-108311062 ATTTGGGGCTGAAGGAGAAAAGG + Intronic
996522418 5:124441903-124441925 CTGTGCTTCTGGAGGAGCAGAGG - Intergenic
997566135 5:134887930-134887952 CTGTGGTGCTGGAGGAGCGGAGG + Exonic
997717106 5:136050534-136050556 CAGAGGTCCTGGAGTAGAAAGGG - Intronic
997999063 5:138609887-138609909 GTGGGGTCCTGAAGGAGAAATGG + Intergenic
998106382 5:139471748-139471770 CTGGGGTCCTGGAGGAGAGGGGG - Intergenic
998349032 5:141489015-141489037 CTGGGGAGCTGGAGGAGGAGAGG - Intronic
998667927 5:144319769-144319791 CTGTGTTGCTTGAGTAAAAATGG + Intronic
999418972 5:151424327-151424349 CAGTGATGCTGGAGGAAGAAAGG + Intergenic
999561403 5:152807532-152807554 AAGTGCTGCTGGAGGAGAGAAGG - Intergenic
1000110226 5:158101048-158101070 CTGTGGTGAAGTATGAGAAAAGG + Intergenic
1001169525 5:169405565-169405587 CTTTGGTGTTCTAGGAGAAATGG - Intergenic
1002132834 5:177091957-177091979 GTGTGGGGCTGGAGGAGCAGAGG + Intronic
1002192030 5:177483414-177483436 TTGTGGCACTGGAGGTGAAAGGG + Exonic
1002825576 6:770356-770378 CTTTGGGGCTTGGGGAGAAAGGG + Intergenic
1002866958 6:1130258-1130280 CTGTGATGATGGTGGAGTAAAGG - Intergenic
1002895335 6:1376819-1376841 CTGTGCTGGTGGCAGAGAAAGGG - Intergenic
1003427488 6:6007342-6007364 CTGTGGTGCTGATGGAGGAGGGG - Intronic
1004741057 6:18461601-18461623 CTCTGGTTCTGGAGATGAAATGG + Intronic
1005285311 6:24320263-24320285 CCGTGGTGCTGGAGTAGAACTGG + Intronic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005732303 6:28709878-28709900 CTGTGTTCCTGGAGCACAAAAGG - Intergenic
1005925758 6:30444221-30444243 CAGTGGAGCAGGAGGAGGAAGGG - Intergenic
1006009679 6:31032053-31032075 GTGTGGTGGGGGAGGAGAGATGG - Intronic
1006104973 6:31710965-31710987 CAGTGGAGCTGAAGGACAAATGG + Intronic
1006368071 6:33627694-33627716 CTGTGGTGGTGGAGGGGTATAGG + Intronic
1006513316 6:34533081-34533103 CGGTGGGACTGGAGGAGGAACGG + Exonic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007308431 6:40925517-40925539 CTGTGCTGTTTGAGGAGAATTGG - Intergenic
1007790495 6:44305704-44305726 AGCTGATGCTGGAGGAGAAAGGG - Exonic
1008191844 6:48468283-48468305 GTGTGGGGATGGAGGAGAAGTGG + Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1010525675 6:76897684-76897706 TAGTGGTGCAGGAGGAGCAAAGG - Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013039944 6:106423654-106423676 CTGGAGGGCTGGAGGAGAAGAGG - Intergenic
1015528990 6:134201874-134201896 CTGATGTGCTGGAGAAGAAAGGG + Intronic
1015888599 6:137946296-137946318 CTGTGGAGCTTGAGGTGGAAGGG + Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1019020318 6:168912597-168912619 CTTTGGTGCTGCAGGAGATGAGG - Intergenic
1019131610 6:169881061-169881083 CTTTAGTCCTGGAGGAGCAAAGG + Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1021058925 7:16085462-16085484 CTGTGGTGCTGAGGCACAAATGG + Intergenic
1021576383 7:22109485-22109507 CTGTGGTCCTGGAAGAGCTATGG - Intergenic
1021694126 7:23259836-23259858 CTGTGGTGCTGCTTCAGAAAGGG - Intronic
1021802048 7:24316837-24316859 CTGTAGGGCTGGAGGGGCAAGGG - Intergenic
1021813420 7:24425349-24425371 GTGTGATGGGGGAGGAGAAAAGG - Intergenic
1023338569 7:39195475-39195497 CTGGGGTCTTGGAGGAGAAGAGG + Intronic
1023560856 7:41471816-41471838 CAGTGGTGATGGAGGACATATGG + Intergenic
1024907807 7:54408271-54408293 CTGTGCTTTTGGAGGAGAAGAGG + Intergenic
1026771290 7:73201581-73201603 CTGGGGGGCTGGAAGACAAAGGG - Intergenic
1026879719 7:73900794-73900816 CTGAGGAGCAGGAGAAGAAAGGG - Intergenic
1027012157 7:74754978-74755000 CTGGGGGGCTGGAAGACAAAGGG - Intronic
1027075884 7:75191076-75191098 CTGGGGGGCTGGAAGACAAAGGG + Intergenic
1027944160 7:84723675-84723697 CTGTGATCATGGAGGAGAAGAGG - Intergenic
1028567891 7:92253144-92253166 CTGGGGTGCTGGACTAGAATTGG - Intronic
1029227834 7:99040978-99041000 GAGTGGTGGTGGAGGAGGAAGGG - Intronic
1029403528 7:100359516-100359538 CTGTGGTGGAGGAGAAGGAAAGG + Exonic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1031417349 7:121509703-121509725 CTCTGGTGGTAGAGGGGAAAGGG + Intergenic
1031761281 7:125716159-125716181 CTGTGCTGTTGGAGGGGACACGG - Intergenic
1032336588 7:131030452-131030474 ACCTGGTGCTGGAGGACAAAGGG + Intergenic
1032413979 7:131722165-131722187 CTCTGATGCTGGAGGGGACATGG + Intergenic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1032898029 7:136273949-136273971 GGGTGGTGCTGCAGGAGAGAAGG + Intergenic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1033231596 7:139602672-139602694 CTAAGGAGCTGGAGGAGGAAAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035038733 7:155912093-155912115 ACGTGGTGCTGGAGCAGGAAGGG - Intergenic
1035626047 8:1071378-1071400 GGGTGGTGCTGGAGGAGGGAGGG - Intergenic
1035727223 8:1832056-1832078 CTGTGGGGCTGGAGGAGCAGCGG + Intronic
1035747483 8:1972979-1973001 CTTTGGTGCTGGAGTTGTAACGG + Intergenic
1036172259 8:6499179-6499201 GTTTGGTCCTGGAGGAGAGACGG + Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037042202 8:14250157-14250179 CTGAGGTGCAGGACTAGAAATGG + Intronic
1037051732 8:14382228-14382250 CTGTGTAGCTGGAGCAGAAGAGG + Intronic
1037272045 8:17141088-17141110 CTGTGGAGCTGGAGCAGAATGGG + Intergenic
1038660919 8:29496055-29496077 CTGTGGTGTTGAAGCAAAAAAGG + Intergenic
1039389936 8:37171478-37171500 CTGTGGTGCTGAAACAGGAAAGG + Intergenic
1039608687 8:38902151-38902173 CTTTAGGACTGGAGGAGAAAAGG - Intronic
1039783961 8:40816025-40816047 CTGTGATGCTGGAGGAAATGTGG - Intronic
1040083914 8:43319164-43319186 CTGTGTTGCTGCAGAGGAAATGG + Intergenic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1041467620 8:58172815-58172837 CCGTGTAGCTGGAGGAGATATGG - Intronic
1042278485 8:67029572-67029594 CTGTGATTCTGGTGGAGAAAAGG + Intronic
1042300873 8:67279337-67279359 TTGTGGTGCTGCAAGAGACAGGG - Intronic
1042422052 8:68602759-68602781 CTCTGGTGCTGAATGGGAAATGG + Intronic
1043289613 8:78580825-78580847 CTCTGGTGCTGGATGAAAATGGG + Intronic
1043323748 8:79024312-79024334 AGGTGGTCCTGAAGGAGAAAGGG + Intergenic
1043640558 8:82444859-82444881 CTGTGGTGCTAGAATAAAAAAGG + Intergenic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1045520163 8:102896523-102896545 CTTTGGTACTGGAGGGGAATTGG - Intronic
1045965135 8:108016008-108016030 CTCGGGTGCTGGAGAAGAATGGG + Intronic
1046800631 8:118422884-118422906 CTGTGGTGTGGGAGGAGCAAGGG + Intronic
1048221538 8:132546746-132546768 CGGTGGTGTGGCAGGAGAAAGGG - Intergenic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1049695777 8:143983726-143983748 CTCGGGAGCTGGAGGAGGAAGGG - Exonic
1049808992 8:144554894-144554916 CTGTGGTGCTGGGGAGGAACTGG - Intronic
1049944882 9:584694-584716 GGATGGTGCTGGAAGAGAAAAGG + Intronic
1049979711 9:892817-892839 CTGAGGAACTGGATGAGAAAAGG - Intronic
1050504175 9:6330013-6330035 CTGAGGGGCTGGAGGAAAACAGG + Exonic
1050544911 9:6701520-6701542 CTGTGGAGGTGGTTGAGAAAAGG + Intergenic
1050639754 9:7654661-7654683 CTGTAATGCTGGAGTGGAAAGGG + Intergenic
1051186264 9:14464504-14464526 CTGAAGTGTTGGAGGAAAAAGGG + Intergenic
1052501120 9:29291750-29291772 CTAGGGTGTTGGAGGAGATAGGG - Intergenic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1053553191 9:39105952-39105974 CTGTGGTGCTGGGTTAAAAACGG - Intronic
1053817304 9:41926126-41926148 CTGTGGTGCTGGGTTAAAAACGG - Intronic
1054107554 9:61069782-61069804 CTGTGGTGCTGGGTTAAAAACGG - Intergenic
1054145154 9:61556516-61556538 CTCTGGTGATGGTGGAGCAAAGG - Intergenic
1054464855 9:65487473-65487495 CTCTGGTGATGGTGGAGCAAAGG - Intergenic
1054613303 9:67261343-67261365 CTGTGGTGCTGGGTTAAAAACGG + Intergenic
1054860393 9:69946902-69946924 CTGTCATGCTGAAGAAGAAATGG + Intergenic
1055520732 9:77078378-77078400 CTATGGAGCTTGAGGGGAAAGGG - Intergenic
1055792875 9:79942466-79942488 CTTTGGTGCTAGAGGGGCAAAGG + Intergenic
1055826469 9:80331243-80331265 CTGTGCTTCTGGTGGAGGAAGGG + Intergenic
1056162489 9:83910690-83910712 AGGTAGTGCTGGAGGAGAAGAGG - Intronic
1057130530 9:92651389-92651411 GGGTGGGGATGGAGGAGAAAGGG + Intronic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057625686 9:96674349-96674371 CTGTGGTGTAGGATAAGAAATGG - Intergenic
1057910311 9:99015272-99015294 GTGTGGTCCTGGAGGAGCAAAGG + Intronic
1059526352 9:114994090-114994112 CTGTGGTGTTGGAGGAGGGGTGG + Intergenic
1059827219 9:118044636-118044658 TTGTGGAGCAGGGGGAGAAATGG - Intergenic
1060290713 9:122300045-122300067 GTGTGATACTGGTGGAGAAAGGG + Intronic
1061216256 9:129223708-129223730 CTGTGGTGCTGGAGTCAGAAGGG + Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1062408734 9:136410676-136410698 CTGTGGTGCTGGCGGCGACGCGG + Exonic
1185736822 X:2501399-2501421 CTGTGGTCCTGGAGGAGGTGTGG - Intronic
1185785834 X:2890263-2890285 AAGTGGTGCAGGAGGAGAAGGGG - Intergenic
1186516311 X:10168307-10168329 CCCTGGTGCTGGAGGAAAAGGGG - Intronic
1186593049 X:10951818-10951840 CTGTGTTGCTGGAGGAAATTAGG - Intergenic
1187065341 X:15830246-15830268 TTGTGGGGCAGGAGGAGGAAAGG + Intronic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1188180409 X:27048507-27048529 CAGTGGTAGTGAAGGAGAAAAGG - Intergenic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1189183020 X:39020847-39020869 CTGGGGGGTTGGAGGAGGAAAGG + Intergenic
1189335372 X:40168007-40168029 CTCTGGTGGGGGAGGGGAAAGGG - Intronic
1191161294 X:57331936-57331958 GTGTGTTGATGGAGAAGAAATGG + Intronic
1191877867 X:65814056-65814078 CAGTTGTGGTGGAGGACAAAGGG - Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192536646 X:71934113-71934135 CTTTGGTCCTGGAGGAGAACTGG - Intergenic
1192751181 X:73993260-73993282 CAGTGGTGCTAGAAGATAAATGG - Intergenic
1195212164 X:102660499-102660521 GTGTGGTGCTGGATCAGGAAAGG + Intergenic
1195218207 X:102721272-102721294 CTGTGGTGCTGGATCAGGAAAGG + Intronic
1195672911 X:107484253-107484275 CAGTGCTGCTGGGGAAGAAAGGG + Intergenic
1195803677 X:108737989-108738011 CTGGGGTGGTGGGGGAGAGAGGG - Intergenic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196904653 X:120419409-120419431 TTGGAGTGCTGGAGGGGAAAGGG + Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1197706775 X:129639859-129639881 CTGCAGTGCTGGAGGTGGAAGGG + Intergenic
1198405976 X:136312807-136312829 CTGGAGTGCTGGGGGAGGAACGG - Intronic
1198591211 X:138184720-138184742 GTGTGGTGCTGGCTCAGAAAAGG + Intergenic
1199096188 X:143743359-143743381 CTATGATACTGGAAGAGAAAGGG + Intergenic
1199530518 X:148842169-148842191 CTGTGTGGATGGAAGAGAAATGG - Intronic
1199640853 X:149859320-149859342 CTGCCATGCTGGAGGAGAAGAGG - Intergenic
1199642010 X:149871507-149871529 CTGGGATGCTGTAGGAGACATGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200120021 X:153785811-153785833 CTGGGGTGCTGGAGTGGGAAGGG + Exonic