ID: 1057407737

View in Genome Browser
Species Human (GRCh38)
Location 9:94788890-94788912
Sequence CACATATCCCAACAAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057407737_1057407742 -1 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407742 9:94788912-94788934 GTGGGATGGGCAAATAGCCCAGG No data
1057407737_1057407750 27 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407750 9:94788940-94788962 AGGGCTGGGGAGACCATCTGTGG No data
1057407737_1057407743 7 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407743 9:94788920-94788942 GGCAAATAGCCCAGGTGTGCAGG No data
1057407737_1057407744 8 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407744 9:94788921-94788943 GCAAATAGCCCAGGTGTGCAGGG No data
1057407737_1057407745 12 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407745 9:94788925-94788947 ATAGCCCAGGTGTGCAGGGCTGG No data
1057407737_1057407747 14 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407747 9:94788927-94788949 AGCCCAGGTGTGCAGGGCTGGGG No data
1057407737_1057407746 13 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407746 9:94788926-94788948 TAGCCCAGGTGTGCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057407737 Original CRISPR CACATATCCCAACAAATAAC TGG (reversed) Intronic
900543549 1:3216191-3216213 CACATATCCCAGCAAGGAGCTGG + Intronic
901339012 1:8478449-8478471 TACACAGCCCAACAAATACCAGG + Intronic
901940041 1:12655080-12655102 CGCACATCCCAACAAACAAATGG + Intronic
902241350 1:15091711-15091733 CACATATTCCAACATATGAATGG + Intronic
902924262 1:19685449-19685471 AACATATCCCAACACAAAAATGG - Intronic
903099935 1:21020531-21020553 CCCTTATCCCAACAGATAAATGG - Intronic
908451556 1:64261116-64261138 AACCTATCCCAACAAGTAAATGG - Intronic
909218306 1:72920803-72920825 CACATATACCAAAAAATTATGGG - Intergenic
910996390 1:93108747-93108769 GAGATATCCAAAGAAATAACTGG - Intronic
911169679 1:94757603-94757625 GACATTTCCAAACAAATAATGGG - Intergenic
911770223 1:101731762-101731784 AAAATATCCCACCAAATCACAGG - Intergenic
914836223 1:151209207-151209229 CAGATAATCCAGCAAATAACTGG + Intronic
918664005 1:187125742-187125764 CACAAATCCAAACATATCACTGG + Intergenic
920900029 1:210100151-210100173 CAGACATCCCAACATATAACAGG + Exonic
921441613 1:215193518-215193540 CACTTATCCCACCAAGTAATTGG + Intronic
921750889 1:218792775-218792797 TACAAATCCCAGGAAATAACTGG + Intergenic
923574943 1:235150053-235150075 AACAAAACCAAACAAATAACGGG - Intronic
1064171697 10:13039259-13039281 CGCATATCTCAAAAAATAGCTGG + Intronic
1064818556 10:19296216-19296238 CACATATCCAAAAAGGTAACAGG - Intronic
1066159412 10:32713039-32713061 CACATATCCCACGAAATACCTGG + Intronic
1066808086 10:39284387-39284409 CAAATATCCCAGGAAAAAACTGG - Intergenic
1067792105 10:49296157-49296179 CTCATATCCCTGCAAATAACAGG - Intergenic
1068349061 10:55820163-55820185 CACATAGCCCACAAAAAAACTGG + Intergenic
1068732999 10:60380626-60380648 ATTATAGCCCAACAAATAACAGG + Intronic
1070464367 10:76704541-76704563 CCCAAATCCCTACAAATACCTGG + Intergenic
1071389845 10:85162050-85162072 CACATATCCTAACAAATTTTAGG - Intergenic
1079832485 11:25286045-25286067 CACATGTTTCAGCAAATAACAGG + Intergenic
1080557016 11:33427229-33427251 CCCATCTCCCAAGAAAAAACAGG + Intergenic
1080841374 11:35986426-35986448 AGCATATCACAATAAATAACAGG - Intronic
1085381187 11:76120299-76120321 AACAAATCACAACAAATTACTGG + Intronic
1087543676 11:99554769-99554791 CACATATCACACATAATAACTGG - Intronic
1089766327 11:120769601-120769623 CACACATACAAACAAAAAACAGG + Intronic
1092716788 12:11397389-11397411 CACAAATCTCAACAAAGCACTGG - Intronic
1092767835 12:11869511-11869533 CACCTATCACGACAAATCACCGG + Exonic
1094134518 12:27110130-27110152 TACATCACCCAACAAATAAGAGG + Intergenic
1094184647 12:27627972-27627994 TACATCACCCAACAAATAAGAGG + Intronic
1097244206 12:57597497-57597519 CACATACCCCAACCACTTACTGG - Intronic
1097518847 12:60643472-60643494 CACATGTGGCAACAAATAAAAGG + Intergenic
1098793768 12:74862353-74862375 CAGACAACCCAACAAATAAATGG - Intergenic
1099905466 12:88764818-88764840 CATATATCTAAACAAACAACTGG - Intergenic
1101254189 12:102961430-102961452 TACAAAACCCAACAAAGAACGGG + Intergenic
1101260108 12:103020245-103020267 CACATAGCCAAACAAAAAATGGG - Intergenic
1105910280 13:24857948-24857970 AAGAAATCACAACAAATAACTGG + Intronic
1106193069 13:27471183-27471205 CATATATAAAAACAAATAACAGG - Intergenic
1108946463 13:56031747-56031769 CACATAGCCAAAGAAGTAACAGG + Intergenic
1110516916 13:76424031-76424053 CACCTATCCCAAGGAAAAACTGG + Intergenic
1114661870 14:24351590-24351612 AACATATCCCCACAGATAAGGGG + Intergenic
1117088382 14:52224496-52224518 CAGCAATCCCCACAAATAACTGG + Intergenic
1120304791 14:82755751-82755773 CACATATCTCAAAACATCACTGG + Intergenic
1120494202 14:85213854-85213876 CACAAATCTCAGCAAATACCAGG - Intergenic
1123573771 15:21644295-21644317 CACAAATCCCTAGAAATAAGAGG + Intergenic
1123610389 15:22086880-22086902 CACAAATCCCTAGAAATAAGAGG + Intergenic
1123807895 15:23894330-23894352 CACATAACCAAAAAAATCACAGG + Intergenic
1123895524 15:24825922-24825944 CGCATATACCAACAAATCATAGG + Intronic
1124254582 15:28130445-28130467 CACATACCCCAATAAAAATCTGG + Intronic
1130121877 15:81057129-81057151 CAAATAACCCAACTAAAAACTGG - Intronic
1202982636 15_KI270727v1_random:378634-378656 CACAAATCCCTAGAAATAAGAGG + Intergenic
1137062709 16:35806354-35806376 CACATATCCAATAAAATAAGTGG + Intergenic
1137849652 16:51727901-51727923 CAAATAACCCAACAGATAAGTGG + Intergenic
1139765800 16:69228880-69228902 CAAACCTCCCAACAAATAAACGG + Intronic
1148882457 17:50740377-50740399 CACTTAAACCAACTAATAACTGG - Intronic
1151846692 17:76660898-76660920 CACAGATCCTATTAAATAACTGG + Intergenic
1153120105 18:1713046-1713068 CACATATACTAACAAGTAAAGGG - Intergenic
1153551659 18:6268796-6268818 CACATATCCCAATCAGTACCTGG - Intronic
1153724217 18:7938555-7938577 CAAATATCCCAACTGTTAACTGG - Intronic
1154402351 18:14052465-14052487 CACAATTTCCAACAAATAAGAGG - Intergenic
1156154526 18:34286374-34286396 CAGATTTCCCAACATATAGCAGG + Intergenic
1156337196 18:36182565-36182587 CAAATTTCCCAACAAATATCAGG - Intergenic
1156914116 18:42445401-42445423 AACATCTACCAACAAACAACTGG - Intergenic
1164474236 19:28562889-28562911 AGCATATCCCCACAAAAAACAGG - Intergenic
925235835 2:2276531-2276553 AACAAACCCAAACAAATAACTGG - Intronic
929211558 2:39363345-39363367 AACAAAACCCACCAAATAACTGG + Intronic
929381244 2:41356786-41356808 CATATATCACAATAAATAAAAGG - Intergenic
929480343 2:42300635-42300657 CCCATATCTCAGCAAATAAAGGG + Intronic
930082109 2:47459284-47459306 CAGATATCCCAAAAAATACTAGG + Intronic
930390806 2:50759935-50759957 CACCTGTCCCTCCAAATAACTGG - Intronic
932509483 2:72271201-72271223 AACAAATCCCAACAAATGAAAGG - Intronic
936284731 2:111173289-111173311 CTTAAATCCCAACAAATACCTGG - Intergenic
939034493 2:137114426-137114448 CATACATCCCCACAAATAAGGGG - Intronic
940264859 2:151826138-151826160 AACAAAACCCAACAAATATCTGG + Intronic
947268726 2:228309070-228309092 CACATAGCCCATGAAAAAACTGG + Intergenic
1172087768 20:32401450-32401472 AACATATCACCACAGATAACGGG - Intronic
1177919778 21:27137217-27137239 TAAATATACAAACAAATAACTGG + Intergenic
1178040195 21:28631870-28631892 CACATACAACAACAAATAAATGG + Intergenic
1179940273 21:44634826-44634848 CACATACACCAACAAATAGAAGG + Intronic
1182710372 22:32318911-32318933 AAAATATCCCACCAAATATCAGG - Intergenic
1185283176 22:49984348-49984370 CACACAACCCAACTAAAAACTGG - Intergenic
950042165 3:9927212-9927234 CACATTCCCCAACACATAGCAGG + Intronic
950584806 3:13884516-13884538 CACATATCACAACAAATTAGTGG + Intergenic
951053504 3:18121292-18121314 CAAATATCACAACAAAGAATGGG - Intronic
951256734 3:20458460-20458482 CACATATAAGAACAAAGAACAGG - Intergenic
951625005 3:24650211-24650233 CATAAATTCCAACAAATAACAGG - Intergenic
954844160 3:53540461-53540483 CACATATCCCAACAAAGTGGAGG - Intronic
955707563 3:61744515-61744537 AACATATCCGAACACATAAAAGG + Intronic
955988509 3:64600364-64600386 AAAATATCCAAACAAAAAACAGG + Intronic
956557979 3:70542604-70542626 CACATAGCCCTACAAATACAGGG - Intergenic
957156815 3:76554278-76554300 CACATATCACAGCAAATGTCAGG + Intronic
958865801 3:99500228-99500250 CACATCTCCCTAAAGATAACAGG + Intergenic
962163836 3:133028109-133028131 CATATATCCAAACAAACAAAAGG - Intergenic
964082137 3:152772396-152772418 CACATCTCCTTACAAATCACAGG + Intergenic
965152525 3:164997716-164997738 CACATATTCTAACTTATAACTGG - Intronic
965434285 3:168628603-168628625 CATATATGCCCACAAATAATTGG - Intergenic
966655650 3:182355235-182355257 GACAAATCTCAACAAATAAATGG + Intergenic
970373580 4:15433679-15433701 CACATATCACCAGAAATCACAGG + Intronic
974648075 4:64719180-64719202 CACATAGCCCATGAAAAAACTGG + Intergenic
974763584 4:66309742-66309764 CAGATAACCGAACAAAAAACTGG + Intergenic
975299117 4:72768485-72768507 CACTTCTCCCTCCAAATAACTGG + Intergenic
977250638 4:94684605-94684627 CAATCATCCCAACAAAGAACAGG - Intergenic
977609039 4:99013840-99013862 CACACATCCTAACATTTAACCGG + Intronic
977936216 4:102808175-102808197 CACATATCCCATCTAAAAAAGGG + Intronic
979382697 4:120027261-120027283 GACATGTCCCAGAAAATAACAGG + Intergenic
979598457 4:122559730-122559752 CACTTATGCCTACAAATAATTGG - Intergenic
980271744 4:130593073-130593095 TGCATTTCCCAATAAATAACAGG - Intergenic
981216332 4:142173386-142173408 GATATATACCAACCAATAACAGG + Intronic
981908749 4:149953736-149953758 CACAAATCCCAAACAATGACTGG + Intergenic
982420832 4:155195271-155195293 CAAATATGCCAATAAATAAAGGG - Intergenic
984479830 4:180285800-180285822 CCCAAAACCCAATAAATAACAGG - Intergenic
985044294 4:185924648-185924670 CACATAGCCCGTGAAATAACTGG - Intronic
987507997 5:18798216-18798238 CACATACCCCAAGAAAAAACTGG + Intergenic
988511451 5:31867948-31867970 CACAAATCCTGACAAATAGCAGG - Intronic
996569003 5:124912266-124912288 CATATATACCAGCAAATAAAAGG - Intergenic
999922979 5:156342897-156342919 CACATATTCCAACATATACTAGG + Intronic
1002188796 5:177468358-177468380 CACACATACCAACACAAAACTGG - Intronic
1003488812 6:6602758-6602780 AACAGCTCTCAACAAATAACAGG - Intronic
1008118894 6:47587380-47587402 AAAATATCCCATGAAATAACGGG - Intronic
1008224999 6:48904158-48904180 CACATATCACAAAGAAAAACAGG + Intergenic
1010230958 6:73534917-73534939 CATATATCCAAACAAAGAATTGG + Intergenic
1011579366 6:88842183-88842205 CAGACATCCTAACACATAACAGG + Intronic
1012326207 6:97921264-97921286 AACAAATCACAACAAATGACAGG + Intergenic
1013056638 6:106589562-106589584 CAGCTCTCCCAACAAATGACTGG + Intronic
1016909089 6:149179302-149179324 AACATATCCCAACAATAACCAGG + Intergenic
1020931255 7:14398255-14398277 CACATTTACCAATAAATAAATGG + Intronic
1023695370 7:42840534-42840556 CCCATTTCCCAACAAATTAATGG - Intergenic
1027606060 7:80300363-80300385 CACATCTCCCAATAAAGAACAGG + Intergenic
1028292193 7:89079089-89079111 CACATATCTTGACAAATCACTGG - Intronic
1030266411 7:107626418-107626440 CAGAAATCGCAACAAATAACTGG + Intronic
1031633452 7:124072710-124072732 GACATATCACATCAAATAAGCGG - Intergenic
1033061198 7:138110017-138110039 CACATATTCCAAGAAAAAAACGG + Intronic
1035686173 8:1524924-1524946 GAAAAATACCAACAAATAACCGG - Intronic
1037287485 8:17316987-17317009 CCCATATCCCAACTAATACTTGG + Intronic
1038390147 8:27190091-27190113 CAAAAATACTAACAAATAACTGG + Intergenic
1039114717 8:34080100-34080122 CAGATATCCCAACAAAGAATAGG + Intergenic
1039309594 8:36301996-36302018 CACATATCCCAATAGATAGATGG - Intergenic
1039651937 8:39351375-39351397 CATATATACCAACAATGAACAGG + Intergenic
1040660135 8:49563279-49563301 CACACATCCCCAGAAAAAACTGG - Intergenic
1040988116 8:53318489-53318511 CACATACCCCGCCAAAAAACTGG - Intergenic
1041016805 8:53599371-53599393 CACCTATCCACACAAACAACTGG + Intergenic
1041160505 8:55037656-55037678 CACATATACCAAGAGACAACTGG - Intergenic
1042683771 8:71415251-71415273 CTCATATCCAAACAAAGAATTGG - Intronic
1043911147 8:85865554-85865576 CACATATTCCAACAGACCACAGG + Intergenic
1046051766 8:109031566-109031588 CATATATTTCAACAAATAAAAGG - Intergenic
1047092524 8:121589585-121589607 CACATATCCCAACCAAAAAGAGG + Intergenic
1049915400 9:312491-312513 CACACATCCCCTCAAATAATAGG - Intronic
1052058287 9:23927380-23927402 CACATAACCCAACATAAAAATGG + Intergenic
1052153252 9:25147475-25147497 CAAATAACCCAACAAAAAAATGG + Intergenic
1052634097 9:31078523-31078545 TACATATCCCATCACAAAACTGG - Intergenic
1055368339 9:75570224-75570246 TACACATCCCTCCAAATAACTGG - Intergenic
1055690080 9:78820670-78820692 CAGATATTCCAATAAATATCTGG + Intergenic
1055999859 9:82203407-82203429 CACTTATAACAGCAAATAACAGG + Intergenic
1057407737 9:94788890-94788912 CACATATCCCAACAAATAACTGG - Intronic
1060588907 9:124803751-124803773 CACAGATCCCAGCAAATACGAGG - Intronic
1186187532 X:7036319-7036341 CAAATATCCCAATAAATTCCTGG - Intergenic
1187174732 X:16886017-16886039 AACATATACCAACACATCACTGG - Intergenic
1188689517 X:33112350-33112372 CACGTATCCCTACAGATAAGGGG + Intronic
1190375942 X:49788334-49788356 CACAGATCACACCAAATAGCTGG - Intergenic
1191079020 X:56488741-56488763 CACATATCCCAGCTCAGAACAGG - Intergenic
1193106077 X:77674881-77674903 CACCTATCCCATAAAATAAATGG + Intronic
1193737565 X:85177436-85177458 CACACATCCCAGCAAAGGACTGG - Intergenic
1194207388 X:91028491-91028513 CACATAGCCCATGAAAAAACTGG + Intergenic
1196974587 X:121144786-121144808 GACAAATGCCAATAAATAACAGG - Intergenic
1197662401 X:129188320-129188342 CACATAGCCCAGGAAAAAACTGG + Intergenic
1197693357 X:129525099-129525121 CACATGTCCCCACAAAAAAAAGG - Intergenic