ID: 1057407743

View in Genome Browser
Species Human (GRCh38)
Location 9:94788920-94788942
Sequence GGCAAATAGCCCAGGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057407737_1057407743 7 Left 1057407737 9:94788890-94788912 CCAGTTATTTGTTGGGATATGTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1057407743 9:94788920-94788942 GGCAAATAGCCCAGGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057407743 Original CRISPR GGCAAATAGCCCAGGTGTGC AGG Intronic
No off target data available for this crispr