ID: 1057408123

View in Genome Browser
Species Human (GRCh38)
Location 9:94792077-94792099
Sequence AACAGGACCAGGATTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057408123_1057408127 0 Left 1057408123 9:94792077-94792099 CCAGCTCTAATCCTGGTCCTGTT No data
Right 1057408127 9:94792100-94792122 ACAAACTAGTTAGGAGTCCTTGG No data
1057408123_1057408125 -9 Left 1057408123 9:94792077-94792099 CCAGCTCTAATCCTGGTCCTGTT No data
Right 1057408125 9:94792091-94792113 GGTCCTGTTACAAACTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057408123 Original CRISPR AACAGGACCAGGATTAGAGC TGG (reversed) Intronic