ID: 1057411727

View in Genome Browser
Species Human (GRCh38)
Location 9:94822228-94822250
Sequence CAAGATCAACACATCCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057411727_1057411730 4 Left 1057411727 9:94822228-94822250 CCTTTAAGGATGTGTTGATCTTG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1057411730 9:94822255-94822277 AAGCTGAAACAGCAGCAGGAGGG No data
1057411727_1057411728 0 Left 1057411727 9:94822228-94822250 CCTTTAAGGATGTGTTGATCTTG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1057411728 9:94822251-94822273 TTAGAAGCTGAAACAGCAGCAGG No data
1057411727_1057411729 3 Left 1057411727 9:94822228-94822250 CCTTTAAGGATGTGTTGATCTTG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1057411729 9:94822254-94822276 GAAGCTGAAACAGCAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057411727 Original CRISPR CAAGATCAACACATCCTTAA AGG (reversed) Intronic
901559892 1:10061808-10061830 CAACATCAGCAGATGCTTAATGG - Intronic
904304845 1:29581791-29581813 CAAGAGCAAATCATCTTTAAAGG + Intergenic
904407746 1:30304386-30304408 CAGCATCATCACCTCCTTAAAGG + Intergenic
908409364 1:63847308-63847330 CAAGAACTACTCATCCTTCACGG + Intronic
909094691 1:71272125-71272147 AAAAATAGACACATCCTTAAAGG + Intergenic
909876997 1:80818992-80819014 AAAGGCCAACACATCCTTGATGG - Intergenic
910622950 1:89275771-89275793 AAAGATCAACCTTTCCTTAATGG + Intergenic
912337918 1:108880027-108880049 TAAGATCTACCCATCCTTCAAGG + Intronic
916489059 1:165285559-165285581 CAAGGTGAACACATGCTTATGGG + Intronic
918568821 1:185962626-185962648 CACGATAAACATATCGTTAACGG - Exonic
921819509 1:219601237-219601259 CGTGATTAACACATGCTTAAAGG - Intergenic
1063026602 10:2185013-2185035 AAAGATGAACACATCCATATTGG + Intergenic
1068110186 10:52671178-52671200 CATTCTCAACAAATCCTTAAGGG + Intergenic
1068194432 10:53697560-53697582 CAAGAAGAACACATCTGTAATGG + Intergenic
1069100998 10:64320333-64320355 GAAAATCAATTCATCCTTAATGG + Intergenic
1071554133 10:86589388-86589410 CAAGAATAACACATCCTGATGGG - Intergenic
1074677358 10:115867162-115867184 CAACATTAACACTTTCTTAAAGG - Intronic
1077913123 11:6591511-6591533 CAAGATAAACACATCTTGAATGG - Intronic
1079282772 11:19102816-19102838 CCAGATAAACACATTCTAAATGG - Intergenic
1080339355 11:31241778-31241800 CAATATAAATACATCCTTCATGG - Intronic
1083589076 11:63882127-63882149 CCAGATCTACACATACTAAAAGG - Intronic
1086735069 11:90296281-90296303 AAAGATCAACACAGACATAATGG - Intergenic
1087882966 11:103440656-103440678 CAATAACAACAAATCATTAAAGG + Intronic
1088296256 11:108298853-108298875 CAAGATCAACACATAATTAGTGG + Intronic
1091835839 12:3585180-3585202 CAATAGGAACACATTCTTAAGGG - Intronic
1094034426 12:26052248-26052270 CAAGATCAATGCTTTCTTAAAGG - Intronic
1096216857 12:49802680-49802702 CAACATCAACACTGCTTTAAGGG + Intronic
1096357548 12:50954214-50954236 AAAGTTCAACACATGCTTAGAGG - Intronic
1097896935 12:64834133-64834155 CAAGATCTATACACTCTTAAAGG - Intronic
1098146176 12:67499842-67499864 AAACATCAACAGAGCCTTAAAGG - Intergenic
1104076995 12:125398750-125398772 CAAAATCACCACAAACTTAAAGG + Intronic
1106485983 13:30173020-30173042 CATGCTCAACAGAGCCTTAAGGG - Intergenic
1108034370 13:46273293-46273315 CCAGAACAAAACATCCATAAAGG + Intronic
1109694664 13:65938326-65938348 AGATATCAACACATTCTTAATGG + Intergenic
1111235015 13:85398476-85398498 AAAGAGCAACAAATCCATAAGGG - Intergenic
1112724690 13:102289776-102289798 CATGCTCAACACATGCTTAGAGG + Intronic
1113060829 13:106321091-106321113 CAATATCAGCACTTGCTTAAGGG + Intergenic
1115171537 14:30513555-30513577 CAATAGCTACACATCATTAATGG + Intergenic
1120501601 14:85303954-85303976 CAAGGTCAACACATCCTAAATGG + Intergenic
1120653292 14:87160219-87160241 AAAGATCAAACAATCCTTAAAGG + Intergenic
1121076231 14:91070934-91070956 CAAGAGCAACACAATGTTAAAGG + Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124892726 15:33747967-33747989 CAAGGTCAAAACATCCTTTGTGG - Intronic
1127976657 15:64002394-64002416 GAAGATGAACACATTTTTAAAGG + Intronic
1132269728 15:100513119-100513141 CAAGAGAAACACATCTTGAAGGG - Intronic
1133627893 16:7589222-7589244 CAACAACAACACATCTTTGAAGG - Intronic
1141878441 16:86842184-86842206 CAACATCAAGACTTCCTTGAGGG - Intergenic
1143157125 17:4844819-4844841 CAACAACAACACATTTTTAAAGG - Intronic
1144293276 17:13847414-13847436 AATAATCAAGACATCCTTAAAGG - Intergenic
1144685096 17:17220990-17221012 CAAGATCAAATCATCCCTGATGG + Intronic
1146105195 17:30028625-30028647 CCTGATCAACAAATCCTTATTGG + Intronic
1155075417 18:22349645-22349667 CAAAAACAACACAACCTAAAAGG - Intergenic
1155759348 18:29546476-29546498 CAAAATCAACACATCCGAAATGG + Intergenic
1156803993 18:41154322-41154344 CAAGATGAACACATTTTTCACGG - Intergenic
1156876088 18:42013897-42013919 CAATATTAACTCATCTTTAAGGG + Intronic
1165568029 19:36749118-36749140 CAACATCAACAAATCCATACTGG - Exonic
925807922 2:7670928-7670950 CCAGTTCAACACATCCTGAGTGG + Intergenic
940315972 2:152327897-152327919 CAAATTCCACACATCCTGAAAGG - Intergenic
947130235 2:226915249-226915271 CAAGTTCTACACATTCTTGAAGG - Intronic
947353159 2:229267551-229267573 GGAGGTCAACACATCCTTAAAGG - Intronic
1170041510 20:12044684-12044706 TAAAATCAACACATTATTAAAGG - Intergenic
1172550361 20:35794331-35794353 CAAGATAAGCACATACATAAGGG - Intronic
1172845038 20:37925214-37925236 CAATATCCACCCATCCTTCAAGG + Intronic
1172892946 20:38279879-38279901 CTTGATGAACACATCCTTAGCGG + Intronic
1173699007 20:45049996-45050018 CAGGATTAACAAAACCTTAAAGG - Intronic
1178961666 21:37072161-37072183 CAAGACCACGACCTCCTTAAGGG + Intronic
1182720987 22:32399814-32399836 AAGGATGACCACATCCTTAAAGG + Intronic
1185051842 22:48558071-48558093 CAAGATCAGCACAACCTCCAGGG + Intronic
953778615 3:45844909-45844931 CAACATCCACACATTCTTAGAGG - Intronic
954981062 3:54745610-54745632 CAAGCTGCAAACATCCTTAAAGG - Intronic
955340114 3:58118567-58118589 CAAGATCAAAACAGTCCTAAGGG - Intronic
960631350 3:119734491-119734513 CAACATAAACACATGATTAAAGG - Intronic
964311746 3:155401270-155401292 CAAGATCAATACATTTGTAATGG - Intronic
964782335 3:160354345-160354367 CAAGTTCCACTCATTCTTAAAGG - Intronic
965106248 3:164358901-164358923 CAAAATCCACACATACTCAAGGG + Intergenic
966059488 3:175737378-175737400 GAAGTTCAAAACAACCTTAAAGG + Exonic
972058237 4:34831514-34831536 CAAGATGAGCACATCATTTACGG - Intergenic
972762316 4:42118993-42119015 CTAGATCAAGACAACCTTAGGGG - Intronic
974193795 4:58542756-58542778 CAAAATCAATACATCTTTCATGG + Intergenic
980984167 4:139679482-139679504 CAAGTTCTACACAACCTTGAAGG - Intronic
981001547 4:139833563-139833585 CAAGATCATCACAACCCTAGTGG + Intronic
982126934 4:152191928-152191950 CAAGATGAACAAATCCTATAGGG - Intergenic
982462304 4:155685934-155685956 CAAGGTCAATTCATCCTTGATGG - Intronic
986473605 5:8100729-8100751 CAAAATTCACACATACTTAAAGG + Intergenic
987599467 5:20047282-20047304 GAACATCAATAAATCCTTAAGGG + Intronic
989216145 5:38907062-38907084 CAAGAGAAACACATCCCAAAAGG + Intronic
990266937 5:54086920-54086942 CAAAGTCAACACATACTTTATGG + Intronic
991258685 5:64643397-64643419 CAAATTCAATACATCTTTAAGGG + Intergenic
993173828 5:84455980-84456002 CAAGCCCAACACTTCCTTACTGG - Intergenic
995317451 5:110792045-110792067 CAAGGTCACCATACCCTTAAAGG - Intergenic
1000613876 5:163406659-163406681 GAAGATCAACCAATCCTTACAGG + Intergenic
1001913753 5:175542315-175542337 CAAGATCAACAGGCCCTGAAAGG + Intergenic
1002760938 6:201695-201717 CAATATAAACTCAACCTTAAAGG - Intergenic
1002853606 6:1018828-1018850 CAAGATGAAAACATCTTCAATGG + Intergenic
1003952870 6:11133421-11133443 CAAGATAAACAGATACGTAAGGG - Intronic
1004674740 6:17830687-17830709 CAAGATCAACACAAGCCTAAAGG - Intronic
1005395677 6:25379437-25379459 CAAATTCTACACATCCTTCATGG - Intronic
1008215793 6:48786859-48786881 CAACAACAACAAATACTTAAAGG - Intergenic
1009559080 6:65215238-65215260 CATGAACCACACATTCTTAATGG - Intronic
1009566139 6:65313353-65313375 CGTGATTAACACATGCTTAAAGG + Intronic
1010794204 6:80100670-80100692 CAAGCTCAACATATCTTTCAGGG - Intergenic
1012494602 6:99820427-99820449 GAAGATCCACCCATCCTTGAAGG + Intergenic
1014784363 6:125600520-125600542 TAAGCTCAGCATATCCTTAAAGG - Intergenic
1016049390 6:139514487-139514509 CTGGATCATCACCTCCTTAAGGG + Intergenic
1018396848 6:163384580-163384602 TAATAGCAACACATCCTTAAGGG - Intergenic
1018999272 6:168734838-168734860 CAAGATCAAGCCATTCATAAAGG + Intergenic
1022832988 7:34086914-34086936 CAAGATGAACACAGCCCAAAAGG + Intronic
1023674502 7:42616108-42616130 TATCATCAACACAGCCTTAAAGG + Intergenic
1024878889 7:54061962-54061984 CAAGAGCAACACCTTCCTAAGGG - Intergenic
1027811711 7:82910149-82910171 CATCATCAACAAATCTTTAAAGG - Intronic
1028459351 7:91073197-91073219 CATGATCAACAGATTCTTCAAGG + Intronic
1028944972 7:96569154-96569176 TAATATCATCACATCCTTATTGG - Intronic
1031396086 7:121276171-121276193 CAAAATCAGCATATCCTTAGAGG + Intronic
1038619189 8:29123915-29123937 CCAGATGAACACATCAGTAATGG - Intronic
1039951057 8:42173053-42173075 AAAGAGCAACACATCATTACCGG - Intergenic
1041768911 8:61451724-61451746 CATGGTCAACACATCATTATTGG - Intronic
1042346707 8:67734884-67734906 TAAGATAAAGACATTCTTAAAGG + Intronic
1043506835 8:80910848-80910870 CAACAACAAAAGATCCTTAAAGG - Intergenic
1043711743 8:83427913-83427935 CCAGATCAACATATCCTGGAAGG + Intergenic
1046051187 8:109024527-109024549 CTGGATCACCACATCCTTCAGGG - Intergenic
1046953114 8:120036839-120036861 CAAGATCAGAAATTCCTTAACGG + Intronic
1050422905 9:5485375-5485397 AAAGATCAAAAGATCCTTTAGGG + Intergenic
1052902176 9:33802743-33802765 CAAGATCAATGCATCCTTGAGGG - Intergenic
1057411727 9:94822228-94822250 CAAGATCAACACATCCTTAAAGG - Intronic
1057645378 9:96869289-96869311 CAAGTTTAATTCATCCTTAATGG + Intronic
1059040544 9:110810524-110810546 CCAGAACAACACAGCCCTAAAGG + Intergenic
1061307844 9:129742593-129742615 AAATATCAACACATACTTTAAGG - Intronic
1187018630 X:15356535-15356557 CAGAATAAACACAACCTTAATGG - Intronic
1188655231 X:32685900-32685922 TAAAATCAACACATAATTAACGG - Intronic
1194673651 X:96767037-96767059 CAAGATCAAGACAGGCTTCATGG - Intronic
1198129955 X:133683688-133683710 CAAGTCTAACACATCCTGAATGG + Intronic