ID: 1057412071

View in Genome Browser
Species Human (GRCh38)
Location 9:94825546-94825568
Sequence GCCTAGGGAGGGCGCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057412071_1057412077 16 Left 1057412071 9:94825546-94825568 CCAGGGGAGCGCCCTCCCTAGGC 0: 1
1: 0
2: 1
3: 7
4: 139
Right 1057412077 9:94825585-94825607 TCAGTTTTAAGGTTTTCAGTTGG No data
1057412071_1057412076 5 Left 1057412071 9:94825546-94825568 CCAGGGGAGCGCCCTCCCTAGGC 0: 1
1: 0
2: 1
3: 7
4: 139
Right 1057412076 9:94825574-94825596 CACTTTGAAGCTCAGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057412071 Original CRISPR GCCTAGGGAGGGCGCTCCCC TGG (reversed) Intronic
900087120 1:904053-904075 GCATGTGGAGGGAGCTCCCCGGG - Intergenic
900184566 1:1327053-1327075 TCCTGAGGTGGGCGCTCCCCTGG + Intronic
900464556 1:2818946-2818968 GCCTAGGAATGGCGCTGTCCAGG - Intergenic
902287143 1:15414015-15414037 GCCTCGGGAGTGCCCACCCCTGG + Intronic
902690629 1:18108255-18108277 GCCGGGGGAGGGCGCTGGCCGGG + Intronic
904586995 1:31586193-31586215 GACCTGGGAGGTCGCTCCCCTGG + Intronic
904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG + Exonic
906568775 1:46818858-46818880 GCCTGGGGAGGGTGGTGCCCAGG - Exonic
912174707 1:107141294-107141316 GCCTGGGGAGGAGGCTCCGCGGG + Intronic
913093356 1:115494792-115494814 GCCTGGGAAGGGCACCCCCCAGG + Intergenic
913323615 1:117607170-117607192 TCCAAGTAAGGGCGCTCCCCTGG + Intronic
914702810 1:150149929-150149951 GCCCAGCGCGGCCGCTCCCCCGG - Intronic
915107293 1:153542409-153542431 CCCCAGGGAGGGCGCTCCCAGGG + Intergenic
915213149 1:154324843-154324865 GGCTATGGAGGGCAGTCCCCAGG - Exonic
920965779 1:210699501-210699523 GCCTAGGTAGGTGGATCCCCAGG + Intronic
922748374 1:228059730-228059752 CCCTGGGGACGGGGCTCCCCTGG + Exonic
923153688 1:231257267-231257289 GCCAAGGGAGGACTTTCCCCTGG - Intronic
1062959118 10:1559413-1559435 GCCTCTGGAGGACCCTCCCCAGG - Intronic
1067565158 10:47331086-47331108 GCCCAGGGAGGGTGGTCCCTAGG - Intergenic
1067914348 10:50380454-50380476 TCATAGGGATGGCGCTACCCAGG + Intronic
1075731190 10:124637760-124637782 GCCTATGGAGGGCACTCCATGGG - Intronic
1075903543 10:126062372-126062394 TCCTAAGGAGGGGGCTTCCCTGG - Intronic
1076160794 10:128242930-128242952 GGCCAGGGAGGGAGCTTCCCTGG - Intergenic
1077297785 11:1834217-1834239 GCCTGGGGAGGGAGCACACCTGG - Intronic
1078270500 11:9790007-9790029 GCCAAGAGAGGCCCCTCCCCTGG - Intronic
1081488210 11:43547773-43547795 GACTGGGGAGGGGGCTTCCCCGG + Intergenic
1081699701 11:45145482-45145504 GCCTTGGGAGGAGGCTTCCCTGG + Intronic
1090318349 11:125817855-125817877 GCTAAGGGAGGGAGGTCCCCTGG - Intergenic
1090788671 11:130070625-130070647 GCCTGGCGCGGGAGCTCCCCCGG - Intronic
1096112547 12:49038048-49038070 GCAGGGGGAGGGCGCTCCTCAGG + Exonic
1105443070 13:20431294-20431316 GCGTAGGGAGGACGCTGCTCGGG - Intronic
1110176841 13:72567311-72567333 GCCCTGGGAGGCCGCTTCCCAGG + Intergenic
1110337200 13:74346481-74346503 GGCTGGGGAGGGAGGTCCCCTGG - Intergenic
1113493735 13:110712779-110712801 GCCTAGGGAAGGCGCCCCTCGGG + Intronic
1120765539 14:88323983-88324005 GCCTTGGGAGCGAGCTTCCCCGG - Intronic
1122923201 14:104888360-104888382 GCCTGGGGAGGGCTGTCCCATGG + Intronic
1122925603 14:104898087-104898109 CCCTAGGGCTGGCGCACCCCCGG - Intergenic
1123059068 14:105586235-105586257 GGCTTGGGAGGGGACTCCCCTGG + Intergenic
1123083396 14:105706466-105706488 GGCTTGGGAGGGGACTCCCCTGG + Intergenic
1126383009 15:48067377-48067399 GTCTAGGGAGGGCTCACCCATGG + Intergenic
1128654866 15:69453148-69453170 GCATAGGGCGGGCGCTCCTCGGG + Intronic
1128787704 15:70410473-70410495 GTCTAGGGAGAGCTCACCCCTGG - Intergenic
1130319949 15:82833294-82833316 GCGTGGGGAGGGCGCACCGCCGG - Exonic
1132426651 15:101723968-101723990 GCACTGGGAGGGCACTCCCCCGG + Intronic
1132805585 16:1773640-1773662 GCCCAGGTAGGGCGCTCGCGAGG + Intronic
1138246587 16:55471175-55471197 GCAGAGGCAGGGCGTTCCCCAGG - Intronic
1141522024 16:84586968-84586990 GCAGAGGGAGGGGGCTCGCCAGG - Intronic
1141694731 16:85614006-85614028 CCCGAGGAAGGGCGCGCCCCGGG + Intronic
1142307289 16:89292894-89292916 GCCTGGGGAGGGCCGGCCCCCGG - Intronic
1143323180 17:6081029-6081051 GCCCAGGGCGGGCGGTCCCTGGG - Exonic
1144389081 17:14776984-14777006 GCCTTGGGAGTGAGCTCCCTTGG + Intergenic
1147451874 17:40510832-40510854 GCCTGGGGAGGGCTGGCCCCTGG + Intergenic
1148053260 17:44779537-44779559 GCACAGGGAGGGCCCTCCCGGGG - Intronic
1148868586 17:50642334-50642356 TCCTAGGGAGGGCCCTGCCCAGG + Intronic
1149658954 17:58324579-58324601 GCCTATGGAGGGCGGAACCCTGG + Intronic
1150548959 17:66191832-66191854 GCCTGGGGGGCGCGCGCCCCTGG - Exonic
1151819624 17:76490526-76490548 GCATGGGGAGGGCACTGCCCTGG + Intronic
1160999976 19:1905666-1905688 GCCTCAGGACCGCGCTCCCCCGG + Intronic
1162028100 19:7905479-7905501 GGCCAGGGAGGGCGGCCCCCAGG - Intronic
1162751945 19:12834439-12834461 GCCTCGGGAGGGGGCTCCTGGGG - Intronic
1163505973 19:17706521-17706543 GCCCAGGGAGGTCGCACCTCTGG + Intergenic
1163785440 19:19272792-19272814 ACCTAGGCAGGGCGCATCCCTGG + Intronic
1163829975 19:19542969-19542991 GCCCGGGGCGGGCGCTCACCAGG - Exonic
1163849641 19:19655843-19655865 GTCTGGGGAGGGCGGGCCCCAGG - Intronic
1167505679 19:49869893-49869915 GTCCAGGGAGGGAGCGCCCCGGG - Exonic
1168339225 19:55614140-55614162 GCCTGGGCTGGGCGCTCCCGCGG + Exonic
926101388 2:10120579-10120601 GCCTGCGGCGGGCGCTCTCCCGG + Intergenic
928172040 2:29010295-29010317 GCCTAGTGGGCGAGCTCCCCAGG + Intronic
928805115 2:35140827-35140849 GCCTAGGGACGGGGCATCCCTGG + Intergenic
929578111 2:43065326-43065348 GCCTAGGGTGGCAGCTCCCAAGG + Intergenic
930185750 2:48410741-48410763 ACCTGGGGAGGGCGCTGGCCTGG + Intergenic
932058207 2:68467755-68467777 GCCGCGGGACGGCGGTCCCCGGG + Exonic
932892615 2:75609960-75609982 GCCTAGTGAGGGGGCTTCCTTGG + Intergenic
933634648 2:84694139-84694161 GCCCAGGGAGGAGGCTCCACTGG + Intronic
936050827 2:109222619-109222641 GCCTAGGAAGGGTGGTGCCCTGG + Intronic
937982185 2:127622265-127622287 GCCTGGGGAGGCCGAGCCCCAGG - Intronic
944079893 2:195775791-195775813 GCCTGGGAAGGATGCTCCCCAGG - Intronic
948896533 2:240930349-240930371 GCCCAGGGCGGGCTCTCCCGTGG + Intronic
1169414945 20:5408299-5408321 TCCTAGGGAGGCAGCTTCCCTGG + Intergenic
1175844503 20:62051454-62051476 GCCTGGGGAGGGCAGTCCCAGGG - Intronic
1180162486 21:46004396-46004418 GCCTAGGGAAGGAGCTGCGCAGG - Exonic
1180183851 21:46129926-46129948 GCTGAGGGAGGGTGCTGCCCAGG + Intronic
1181639496 22:24189233-24189255 GCCTGGGGAGGGAGCATCCCCGG - Intergenic
1182803585 22:33051975-33051997 GTCTAGGGAGTGTGCTCACCAGG - Intronic
1183653509 22:39172104-39172126 GCTCAGGGAGGGGGCTGCCCAGG - Intergenic
1183746297 22:39693987-39694009 GCCTGGGCAGAGCGGTCCCCAGG + Intergenic
1184088937 22:42282513-42282535 GCCAGGGCTGGGCGCTCCCCCGG - Intronic
1184362333 22:44025849-44025871 GCCCATGGCGGGCGCTCCACAGG - Intronic
1185266516 22:49906954-49906976 GCCCAGGCAGTGCCCTCCCCAGG + Intronic
1185266517 22:49906955-49906977 GCCTGGGGAGGGCACTGCCTGGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
951264833 3:20552943-20552965 TGGTAGGGAGGGAGCTCCCCTGG - Intergenic
961360404 3:126363708-126363730 GCCTAGTGAGGGCTCACCCTCGG - Intergenic
962922956 3:139967088-139967110 GCCTAGGCAGGGCTGACCCCTGG + Intronic
966194308 3:177298114-177298136 GCCTGGGGAGAGAGCTGCCCAGG + Intergenic
968606019 4:1536151-1536173 GCCCAGAGCGGGGGCTCCCCAGG + Intergenic
969303229 4:6309485-6309507 GCCCAGAGAGGGGGCTCCCACGG + Intergenic
986177797 5:5366652-5366674 GCCTAGGCCGGCTGCTCCCCAGG - Intergenic
987594665 5:19981741-19981763 CCCTAGGGAAGGAGCACCCCTGG - Intronic
1001486013 5:172120155-172120177 GCCAAGGGAGGTGGCTCCCCTGG - Intronic
1002061752 5:176629662-176629684 GCCTGGGGAGGGCGATACACGGG + Exonic
1002620128 5:180482216-180482238 GCCTAGGGCAGGGGTTCCCCAGG + Intergenic
1005378203 6:25207146-25207168 GCTTCGGGAGGGAGGTCCCCTGG - Intergenic
1007252205 6:40503429-40503451 GCCGATGGAGGGCGGTCCTCTGG + Intronic
1009959579 6:70501720-70501742 GCTTGGGGAGGGAGGTCCCCTGG + Intronic
1017725474 6:157273795-157273817 TCACAGGGAGGGCCCTCCCCTGG + Intergenic
1019492335 7:1321313-1321335 GCCTGGGGAGGGGGCCTCCCTGG + Intergenic
1020204793 7:6105576-6105598 GCCTGGGGAGGGGGCGCCCAAGG - Intronic
1023247080 7:38216674-38216696 GCATAGGTAGGGCTCTCGCCAGG - Intronic
1024263175 7:47587059-47587081 GCCTGGGGAGGGCTCTCTGCAGG + Intergenic
1025215068 7:57049646-57049668 GCCAGGGTAGGGCGCTTCCCAGG - Intergenic
1025230954 7:57203142-57203164 GCCTCGGGAGGGGGCTCGGCAGG + Intergenic
1025656882 7:63527171-63527193 GCCAGGGTAGGGCGCTTCCCAGG + Intergenic
1026445762 7:70483240-70483262 GCCTAGGTAGGGAGCTCTCAAGG - Intronic
1026980915 7:74526148-74526170 GCCTTGGGAGGGTTCTGCCCAGG + Intronic
1029706287 7:102278061-102278083 GCCGGGTGAGGGCCCTCCCCTGG + Intronic
1029706288 7:102278062-102278084 GCCAGGGGAGGGCCCTCACCCGG - Intronic
1031928521 7:127661459-127661481 GCCTAGGGATGAAGCTCCTCAGG - Intronic
1033369762 7:140697227-140697249 GCCTAGGGAGGGCGCGGTCCAGG + Intronic
1034276556 7:149826378-149826400 TCCCAGGGAGGGAGCTGCCCTGG - Intergenic
1034448679 7:151126143-151126165 GCCTGGGGAGGGCGTTGCCGAGG + Intronic
1034552186 7:151828127-151828149 GCCTGGGGTCGGGGCTCCCCTGG - Intronic
1034824838 7:154252353-154252375 GCCTGGGAAGGCAGCTCCCCTGG - Intronic
1037460276 8:19101700-19101722 GCCCAGGGTGGCAGCTCCCCTGG + Intergenic
1037883637 8:22585252-22585274 GCCCAGGGAGGATGCTGCCCCGG - Intronic
1037977663 8:23224838-23224860 GCCCGGGCAGGGCGCGCCCCAGG - Exonic
1039958226 8:42223489-42223511 GGCAAGGGAGGGCGCTGGCCTGG - Intergenic
1042215718 8:66428698-66428720 GTCTAGAGAGGGCGGTCCCGGGG - Intergenic
1045063232 8:98425962-98425984 CCAAAGGGAGGGGGCTCCCCAGG + Intronic
1047121230 8:121907842-121907864 GGCTGGGGAGGGAGGTCCCCCGG - Intergenic
1049218275 8:141417624-141417646 TTCTAGGGAGGGCGCGCACCGGG + Intronic
1049463138 8:142739308-142739330 ACCTCGGGAGGGCGCGCCCACGG - Intergenic
1049658502 8:143809349-143809371 ACCTAGGGAGGCAGCTCTCCAGG + Intronic
1049795692 8:144496385-144496407 GCCCAGGGCAGGGGCTCCCCCGG + Intronic
1056755959 9:89382255-89382277 GGCTAGAGAGCGCGCTCCACGGG - Intronic
1056783143 9:89566445-89566467 GCCAAGGGAAGGTTCTCCCCTGG + Intergenic
1057263018 9:93596643-93596665 GCCTAGGGAGCTTGCTTCCCAGG + Intronic
1057412071 9:94825546-94825568 GCCTAGGGAGGGCGCTCCCCTGG - Intronic
1058670774 9:107359003-107359025 GCCCAAGGAAGGGGCTCCCCAGG + Intergenic
1060405582 9:123371415-123371437 GCCTCGGAAGGGCCCACCCCAGG - Exonic
1060497496 9:124129342-124129364 GCCCTCGGAGGCCGCTCCCCAGG + Intergenic
1061085122 9:128393826-128393848 GCCTAGGGAGGGGGCTCCAGAGG - Intergenic
1061633357 9:131888429-131888451 GCTTAGGGAGCGCGCAGCCCCGG - Intronic
1062162215 9:135086975-135086997 GCCCTGGGAGGGCGCACACCCGG - Intronic
1062452843 9:136622772-136622794 GGCTAGGGAGAGCGGTGCCCGGG - Intergenic
1193094161 X:77528247-77528269 TCCATGGGAGGGAGCTCCCCAGG + Intronic
1195060748 X:101191625-101191647 GCCCGGGGAGGCCGCTGCCCGGG + Intergenic
1198311988 X:135433344-135433366 GCCGAATGAGGGCGCTCTCCAGG - Intergenic