ID: 1057414118

View in Genome Browser
Species Human (GRCh38)
Location 9:94846190-94846212
Sequence AAATACCATCTGTATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 428}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057414118_1057414120 8 Left 1057414118 9:94846190-94846212 CCTTCAGGATACAGATGGTATTT 0: 1
1: 0
2: 2
3: 29
4: 428
Right 1057414120 9:94846221-94846243 GAAACTGGAGAAGCACAACGTGG No data
1057414118_1057414121 12 Left 1057414118 9:94846190-94846212 CCTTCAGGATACAGATGGTATTT 0: 1
1: 0
2: 2
3: 29
4: 428
Right 1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG No data
1057414118_1057414122 15 Left 1057414118 9:94846190-94846212 CCTTCAGGATACAGATGGTATTT 0: 1
1: 0
2: 2
3: 29
4: 428
Right 1057414122 9:94846228-94846250 GAGAAGCACAACGTGGAAGGAGG No data
1057414118_1057414119 -7 Left 1057414118 9:94846190-94846212 CCTTCAGGATACAGATGGTATTT 0: 1
1: 0
2: 2
3: 29
4: 428
Right 1057414119 9:94846206-94846228 GGTATTTGACGTCATGAAACTGG No data
1057414118_1057414123 18 Left 1057414118 9:94846190-94846212 CCTTCAGGATACAGATGGTATTT 0: 1
1: 0
2: 2
3: 29
4: 428
Right 1057414123 9:94846231-94846253 AAGCACAACGTGGAAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057414118 Original CRISPR AAATACCATCTGTATCCTGA AGG (reversed) Intronic
901384425 1:8898076-8898098 TAAGACCATCTGTAGCTTGATGG - Intergenic
904706830 1:32397214-32397236 AAATGCCATGTATATGCTGATGG + Intergenic
904792312 1:33032656-33032678 AAATACCATGTGCCTCCTCAGGG + Intronic
905160111 1:36025595-36025617 AAACTTCATCTCTATCCTGAAGG + Intronic
905567645 1:38978515-38978537 TAAGACCATCTGTAGCTTGATGG + Intergenic
905980211 1:42218732-42218754 AAAGACAATCTTTATTCTGAGGG - Intronic
906767132 1:48443864-48443886 TAAGACCATCTGTAGCTTGATGG - Intronic
907034342 1:51202912-51202934 AAATATCATTTCTACCCTGAAGG - Intergenic
907692584 1:56684391-56684413 AAATACAGTCTGTCTGCTGATGG - Intronic
907793673 1:57693053-57693075 TAAGACCATCTGTAGCTTGATGG - Intronic
907971990 1:59392111-59392133 AGATGCCCACTGTATCCTGAGGG - Intronic
908300984 1:62761071-62761093 TAAGACCATCTGTAGCTTGATGG - Intergenic
908396070 1:63726955-63726977 AAAGTCCATTTGAATCCTGAAGG + Intergenic
908658941 1:66417748-66417770 TAAGACCATCTGTAGCTTGATGG + Intergenic
909337814 1:74496262-74496284 AAATACCATCTGTGACCAAAGGG + Intronic
909684101 1:78326640-78326662 AAATAGAATCAGTATCATGAAGG - Intronic
910396893 1:86802528-86802550 TAAGACCATCTGTAGCTTGATGG + Intergenic
911232552 1:95376421-95376443 CCATACCATCTGTGTGCTGATGG - Intergenic
911299269 1:96152776-96152798 TAAGACCATCTGTAGCTTGATGG - Intergenic
911751955 1:101505633-101505655 TAAGACCATCTGTAGCTTGATGG - Intergenic
911845257 1:102744820-102744842 TAAGACCATCTGTAGCTTGATGG + Intergenic
912008076 1:104928972-104928994 AAATAGGATCGGTACCCTGATGG + Intergenic
912021789 1:105115154-105115176 TAAGACCATCTGTAGCGTGATGG - Intergenic
913053267 1:115135128-115135150 AAATGGCATCTACATCCTGAAGG - Intergenic
914439230 1:147688961-147688983 AAATAAAATCTGTATGTTGAAGG + Intergenic
914992368 1:152510069-152510091 AAAGACCAGGTGTATACTGAGGG - Intergenic
915261097 1:154677622-154677644 TAAGACCATCTGTAGCTTGATGG - Intergenic
915883395 1:159697597-159697619 AAAGATCATCTGTACCTTGATGG - Intergenic
916084242 1:161257146-161257168 TAAGACCATCTGTAGCTTGATGG - Intergenic
916261794 1:162849599-162849621 AACTACCATCTGAGTCCTCAGGG + Intronic
916405339 1:164492557-164492579 ACATACTATCTGTGTCCTGTTGG + Intergenic
916984649 1:170177740-170177762 AAATATCAACTCTATGCTGATGG - Intergenic
917025130 1:170633146-170633168 AAAACCCTTCTGTTTCCTGAAGG - Intergenic
917086836 1:171312173-171312195 CAAAACCATCTGTAGCTTGATGG - Intergenic
917227893 1:172803433-172803455 TAAGACCATCTGTAGCTTGATGG - Intergenic
917280591 1:173375191-173375213 TAAGACCATCTGTAGCTTGATGG - Intergenic
917445533 1:175103075-175103097 TAAGACCATCTGTAGCTTGATGG + Intronic
918347724 1:183620450-183620472 AAATACAATCCTTATCCTGTGGG - Intergenic
918749771 1:188258223-188258245 TAAGACCATCTGTAGCTTGATGG + Intergenic
919257333 1:195141329-195141351 TAAGACCATCTGTAGCTTGATGG - Intergenic
919559274 1:199097228-199097250 TAAGACCATCTGTAGCTTGATGG - Intergenic
920646127 1:207805697-207805719 AAATACCATCTATAGGCTGTTGG + Intergenic
920756556 1:208739265-208739287 TAAGACCATCTGTAGCTTGATGG - Intergenic
922246399 1:223802606-223802628 AAACAGCATCTGTTTTCTGAGGG + Intronic
922557672 1:226545427-226545449 AACTACCATTTGTATGCTGATGG + Intergenic
923022206 1:230173968-230173990 ATATTCCTTCTGTATCCTTATGG - Intronic
923118772 1:230970439-230970461 TAAGACCATCTGTATGCTGACGG + Intronic
923487269 1:234445361-234445383 AAATACCACCTGTATGTTAATGG + Intronic
923532869 1:234825391-234825413 CACTACCATCTGTCTCCTGGAGG + Intergenic
924305773 1:242687764-242687786 AAAAATCATCTTTATCATGAAGG - Intergenic
1063321162 10:5053874-5053896 TAAGACCATCTGTAGCTTGATGG + Intronic
1063415275 10:5868179-5868201 TAAGACCATCTGTAGCTTGATGG - Intronic
1064197650 10:13259186-13259208 TAAGACCATCTGTAGCTTGATGG - Intergenic
1064603003 10:17012141-17012163 TAAGACCATCTGTAGCCTGATGG + Intronic
1066293504 10:34034989-34035011 TAAGACCATCTGTAGCTTGATGG - Intergenic
1066613703 10:37276090-37276112 TAAGACCATCTGTAGCTTGATGG + Intronic
1067549953 10:47227216-47227238 ATATACCATCTGTTTCCCGCAGG + Intergenic
1068447363 10:57139745-57139767 AACTACCATCTGTGGACTGATGG + Intergenic
1068501192 10:57841329-57841351 TAAGACCATCTGTAGCTTGATGG - Intergenic
1068686932 10:59880259-59880281 AAATACCAACTGTACACTCAGGG + Intronic
1069364667 10:67684729-67684751 TAAGACCATCTGTAACTTGATGG + Intronic
1070092526 10:73302154-73302176 AAATACCATCTATACACTGATGG - Intronic
1071030915 10:81180207-81180229 AAATGTCCTCTGTCTCCTGATGG - Intergenic
1071828557 10:89349762-89349784 AATTAGCCTCTGTATCATGAAGG + Intronic
1071835288 10:89411979-89412001 TAAGACCATCTGTAGCTTGAGGG - Intronic
1071841573 10:89477097-89477119 AACGACCATCCGTATCTTGAAGG - Intronic
1072370782 10:94764734-94764756 TAAGACCATCTGTAGCTTGATGG + Intronic
1073376938 10:103043480-103043502 AGATACCATTTGTATTTTGATGG - Intronic
1074742352 10:116497479-116497501 TAAGACCATCTGTAGCTTGATGG + Intergenic
1075146886 10:119890071-119890093 TAAGACCATCTGTAGCTTGATGG - Intronic
1078745261 11:14107555-14107577 AAATTTGATCTGTATTCTGAAGG + Intronic
1079730687 11:23935500-23935522 TAAGACCATCTGTAGCTTGATGG + Intergenic
1080228601 11:29989611-29989633 ATATACCATCTTTACACTGATGG + Intergenic
1081541116 11:44035382-44035404 AAATGACATCTGTGTCCTGTTGG - Intergenic
1081822350 11:46011674-46011696 AAAGAACATCTGTATTCTGCGGG - Intronic
1082705891 11:56494682-56494704 TAATACCCTCTGTGTACTGATGG + Intergenic
1084211523 11:67626062-67626084 TAAGACCATCTGTAGCTTGATGG - Intergenic
1086054241 11:82628498-82628520 TAAGACCATCTGTAGCTTGATGG - Intergenic
1086112699 11:83217069-83217091 TAATACCATTTGTAGCTTGATGG + Intronic
1086120929 11:83303946-83303968 GAATGCCATCTGTGTCCTGCAGG - Intergenic
1086198887 11:84176110-84176132 AATAACCATCAGTTTCCTGATGG + Intronic
1086379749 11:86240009-86240031 AAGCTCCATCTGTATCTTGATGG + Intergenic
1087075626 11:94125054-94125076 TAAGACCATCTGTAGCTTGATGG - Intergenic
1087458691 11:98420207-98420229 TAAGACCATCTGTAGCTTGATGG + Intergenic
1087915893 11:103810388-103810410 AAATACCATTGCTATGCTGATGG + Intergenic
1088290893 11:108236071-108236093 AAATACCATCTCCATCGTCAAGG + Intronic
1089469034 11:118706251-118706273 ATATGCCATCTGTTTCCTGGTGG - Intergenic
1089601416 11:119617626-119617648 AATTACCATCTGTAGGCTGCTGG + Intergenic
1091477265 12:787704-787726 AAAGACCATCTGTCTTCTGCTGG + Intronic
1091856202 12:3742358-3742380 GAATACCATCTCCATCCTAATGG + Intronic
1093346150 12:18039840-18039862 TAAGACCATCTGTAGCTTGATGG - Intergenic
1093489475 12:19688452-19688474 AAATACTATCTGTATGTTGATGG + Intronic
1094609539 12:31979959-31979981 GACCACCAGCTGTATCCTGATGG + Intronic
1095264581 12:40139085-40139107 ATATGCAATCTGTATCATGATGG + Intergenic
1097428560 12:59475133-59475155 TAAGACCATCTGTAGCTTGATGG - Intergenic
1099069372 12:78026178-78026200 AAATTTCATCTATATTCTGATGG + Intronic
1099355559 12:81630484-81630506 CAATACCTTCCGTATCCTCAGGG - Intronic
1099355717 12:81632800-81632822 AAAAGCAATCTGTGTCCTGAGGG + Intronic
1099414480 12:82370256-82370278 TAAGACCATCTGTAACTTGATGG + Intronic
1099576551 12:84390729-84390751 TAAGACCATCTGTAACTTGATGG + Intergenic
1099797906 12:87421763-87421785 TAAGACCATCTGTAGCTTGATGG + Intergenic
1100050556 12:90444004-90444026 TAAGACCATCTGTAGCTTGATGG + Intergenic
1100210453 12:92393519-92393541 TAAGACCATCTGTAGCTTGATGG - Intergenic
1100410246 12:94310486-94310508 TAATCCCATGTGTATACTGAGGG - Intronic
1100597334 12:96082912-96082934 GAATACCCTCTTTATCCTCAAGG + Intergenic
1100769057 12:97901094-97901116 AAAAACCATCTTTACCCTCATGG + Intergenic
1101705502 12:107217048-107217070 TAAGACCATCTGTAGCTTGATGG - Intergenic
1103167727 12:118784670-118784692 ACGTACCATCTGTTTCCTGCTGG - Intergenic
1104208937 12:126668554-126668576 AAAAACCATCTGTATGTGGAAGG + Intergenic
1104215359 12:126728221-126728243 AAGTTCCATCTGGCTCCTGAAGG - Intergenic
1104347083 12:128009966-128009988 AAATAGCACCTTTATCCTCAAGG - Intergenic
1104767982 12:131342730-131342752 TAAGACCATCTGTAGCTTGATGG + Intergenic
1105763030 13:23531147-23531169 TAAGACCATCTGTAGCTTGATGG - Intergenic
1106163257 13:27219355-27219377 TAAGACCATCTGTAGCTTGATGG - Intergenic
1106643557 13:31609602-31609624 TAAGACCATCTGTAGCTTGATGG + Intergenic
1106653498 13:31717437-31717459 AAATACCATCTGTATTTTTAAGG + Intergenic
1107383480 13:39882176-39882198 GAATGCCATCTGTTTCCTGCTGG - Intergenic
1108185199 13:47881717-47881739 AAGCAACATCTGTATCCTTAAGG - Intergenic
1108515733 13:51200787-51200809 TAAGACCATCTGTAGCTTGATGG + Intergenic
1108818388 13:54317480-54317502 TAAGACCATCTGTAGCTTGATGG - Intergenic
1108849186 13:54706936-54706958 TAAGACCATCTGTAGCTTGATGG - Intergenic
1109694477 13:65935205-65935227 AAATAAAAACTGTAGCCTGAAGG + Intergenic
1110149827 13:72238024-72238046 ATATGCCATCTGTAAGCTGATGG + Intergenic
1112240496 13:97676843-97676865 GAAAACCATGTGTATCCTTAGGG + Intergenic
1112519692 13:100084582-100084604 TAAGACCATCTGTAGCTTGATGG - Intergenic
1113343242 13:109447342-109447364 AAATCCCACATGGATCCTGAAGG - Intergenic
1113715169 13:112499930-112499952 AAATACCATCTATATACCCAAGG + Intronic
1116698171 14:48202546-48202568 TAAGACCATCTGTAGCTTGACGG - Intergenic
1117705890 14:58467654-58467676 ATATACCATCTGGATCTTAATGG - Intronic
1120098378 14:80415555-80415577 AAATACTATCTATATACTGATGG + Intergenic
1120486200 14:85116302-85116324 AAATAACTTCTGTTTTCTGAAGG - Intergenic
1122736336 14:103845404-103845426 AAATACCATCTGTTTCTAAAAGG + Intronic
1125065526 15:35480924-35480946 AAATAGTATATGTTTCCTGATGG + Intronic
1125491206 15:40149873-40149895 AGACACCATCTGTATCATCAGGG - Intergenic
1125670255 15:41467016-41467038 AGATATCATGTGTCTCCTGATGG - Intronic
1126050374 15:44679799-44679821 ATACACCATCTATTTCCTGAAGG - Intronic
1126070639 15:44862281-44862303 TAAGACCATCTGTAGCTTGATGG + Intergenic
1126980964 15:54242216-54242238 AAATAAGTTCTGTATCTTGAAGG + Intronic
1127044658 15:55012928-55012950 GAATACCATCTTTATGCTAATGG + Intergenic
1128241583 15:66104998-66105020 AAATGCCATCTGGTCCCTGATGG - Intronic
1129545107 15:76387510-76387532 AAATACCATCTCTGTGTTGATGG - Intronic
1130728942 15:86469692-86469714 AAATACCCTTTGTATACTGTTGG - Intronic
1131843289 15:96461428-96461450 AAATATCCTCTTTATACTGAAGG + Intergenic
1139313578 16:66047934-66047956 AAATATCATGTGCCTCCTGATGG + Intergenic
1140220694 16:73041619-73041641 AAATGCCATCTCTGTTCTGATGG - Intronic
1140496199 16:75390950-75390972 GAATGCCATCTGTTTCCTGCTGG + Intronic
1144108474 17:12008539-12008561 CAGTACCATCTGGACCCTGAAGG + Intergenic
1145804974 17:27720232-27720254 TAAGACCATCTGTAGCTTGATGG - Intergenic
1146311384 17:31771103-31771125 TAAGACCATCTGTAGCTTGATGG - Intergenic
1146962980 17:37000625-37000647 AAATACAACCTATATGCTGAAGG - Intronic
1147496822 17:40924667-40924689 CAATGCCTTCTGTATCCAGACGG - Intronic
1149144320 17:53471656-53471678 ATGTGCCATCTGTTTCCTGAGGG + Intergenic
1149213904 17:54332170-54332192 TAAGACCATCTGTAGCTTGATGG - Intergenic
1150313840 17:64152077-64152099 ACATACCATCGGTATTCAGAAGG - Intronic
1150513236 17:65778154-65778176 AAACACCACCTTTATCCTGTTGG + Intronic
1151404692 17:73878744-73878766 GAATATCATCAGGATCCTGAAGG - Intergenic
1151567591 17:74907817-74907839 TAAGACCATCTGTAGCTTGATGG + Intergenic
1153100810 18:1467273-1467295 AAATATCATCTGTATCTTATGGG - Intergenic
1153438363 18:5090245-5090267 TAAGACCATCTGTAGCTTGATGG - Intergenic
1155475415 18:26232434-26232456 TAAGACCATCTGTAGCTTGATGG + Intronic
1156638126 18:39055726-39055748 GTACACCATCTGTTTCCTGATGG - Intergenic
1157857022 18:51112580-51112602 TAAGACCATCTGTAGCTTGATGG + Intergenic
1157998062 18:52584126-52584148 AAATACCAGCTGTACTATGAGGG + Intronic
1158060404 18:53333808-53333830 AAATACCACATATATGCTGATGG + Intronic
1158719808 18:59914827-59914849 ACATTCAATCTTTATCCTGATGG - Intergenic
1158805616 18:60968443-60968465 AAATACCTTCAGTAGCATGAGGG - Intergenic
1159284082 18:66326900-66326922 AAAGAAAATCTGTAGCCTGAGGG - Intergenic
1159804526 18:72940168-72940190 ATAGACCATCTGTAAGCTGAGGG + Intergenic
1160007749 18:75080645-75080667 AAATTCCATCTGTCTCATGATGG + Intergenic
1162108478 19:8386172-8386194 TAAGACCATCTGTAGCTTGATGG - Intronic
1162592569 19:11602134-11602156 AAATCCCACCTAGATCCTGAAGG + Intronic
1165249959 19:34522455-34522477 AAATAGCATCTCTATTGTGATGG - Intergenic
1167675204 19:50879742-50879764 AAATCCCATCTTTAGCATGAAGG + Exonic
926386916 2:12344504-12344526 AAATACCATCTGCATAATAAAGG - Intergenic
927381142 2:22480392-22480414 AAAAACCATCTCTACCCTCATGG + Intergenic
927622957 2:24681627-24681649 AAATTTCATCTTAATCCTGAAGG + Intronic
928648673 2:33382477-33382499 AAACACCATCTGTAGCCAGGAGG - Intronic
929087128 2:38179441-38179463 AAATACCATCTACATACCGATGG + Intergenic
929330754 2:40677594-40677616 TAAGACCATCTGTAGCTTGATGG - Intergenic
930039082 2:47106865-47106887 TAAAACCATCTGTAGCTTGATGG - Intronic
930092889 2:47544206-47544228 AAACACCACGTGTATGCTGATGG - Intronic
931289725 2:60861926-60861948 ATGTACCATCTGTTTCCTGTTGG + Intergenic
931540880 2:63327821-63327843 TAAGACCATCTGTAGCTTGATGG - Intronic
931955021 2:67413423-67413445 AAATACCATCACTATTCTGTAGG + Intergenic
932972811 2:76566667-76566689 AAATTCCATCTTTATTGTGATGG + Intergenic
933108508 2:78365233-78365255 AAAGACAATCTGAATCCTGATGG + Intergenic
933342456 2:81040023-81040045 TAACACCATCTGTAGCTTGATGG - Intergenic
934867796 2:97828942-97828964 TAAGACCATCTGTAGCTTGATGG - Intronic
935163366 2:100548443-100548465 AAGTGCCATCAGTATGCTGAAGG - Intergenic
935247980 2:101235986-101236008 TAAGACCATCTGTAGCTTGATGG - Intronic
935663811 2:105492609-105492631 AAATACCTTCAAAATCCTGAAGG - Intergenic
936237460 2:110755398-110755420 AAATACCATCTGTATAACAATGG - Intronic
936802855 2:116288008-116288030 TAAGACCATCTGTAGCTTGATGG - Intergenic
938153260 2:128904256-128904278 TAAGACCATCTGTAGCTTGATGG + Intergenic
939159441 2:138568773-138568795 AAATACCATCTTTATCTTACTGG - Intronic
939693118 2:145290632-145290654 AGCTACCATATATATCCTGATGG + Intergenic
941243827 2:163072497-163072519 TAAGACCATCTGTAGCTTGATGG - Intergenic
941369038 2:164641338-164641360 AAATACCAATTTTATCTTGATGG - Intergenic
942099446 2:172564853-172564875 AAATACTATGTTTATCCTAAAGG + Intronic
942193416 2:173493672-173493694 AAATCCTGTGTGTATCCTGAAGG + Intergenic
943102759 2:183508114-183508136 TAAGACCATCTGTAGCTTGATGG + Intergenic
943902333 2:193456142-193456164 TAAGACCATCTGTAGCTTGATGG - Intergenic
944058819 2:195549708-195549730 AAATACACTCTATATGCTGACGG - Intergenic
944729514 2:202502971-202502993 TAAGACCATCTGTAGCTTGATGG - Intronic
944956458 2:204816887-204816909 AAATACAATCTGTAGGCTGTGGG - Intronic
945432614 2:209781732-209781754 ATTTACCATGTGTATCCTGCAGG + Intronic
945982759 2:216327356-216327378 AAATAGAATCTGTATGCTGGTGG - Intronic
946206054 2:218109469-218109491 TAAGACCATCTGTAGCTTGATGG + Intergenic
946489984 2:220139110-220139132 TTATACCATCTGTCTGCTGATGG + Intergenic
947148707 2:227092185-227092207 AAATGCCATCAAAATCCTGAGGG + Intronic
947450698 2:230205842-230205864 AATTACCACCTTTATACTGATGG - Intronic
948223591 2:236291859-236291881 AAATGCCATCTAAATGCTGATGG - Intergenic
1169998010 20:11580983-11581005 AAAGACTATAAGTATCCTGAAGG - Intergenic
1170424459 20:16224586-16224608 ATATATCATATGTATACTGAAGG - Intergenic
1172340965 20:34157302-34157324 TAAGACCATCTGTAGCTTGATGG - Intergenic
1172877961 20:38177552-38177574 AAATGCCATCTATGTGCTGAAGG + Intergenic
1173756532 20:45521586-45521608 AACTACCATCTGTAGACTTATGG - Intergenic
1173761606 20:45565343-45565365 AAAATCTACCTGTATCCTGAGGG - Intronic
1174512142 20:51061450-51061472 AAATGCCATCTGTGTCTTTAAGG - Intergenic
1174977838 20:55354531-55354553 AAAAACCATTTGGATCCTGATGG - Intergenic
1174979946 20:55382277-55382299 AAACACCACCTGTAGACTGATGG + Intergenic
1175700165 20:61131101-61131123 GAATGCCATCTGTGTCTTGATGG - Intergenic
1177569923 21:22874288-22874310 AAATATCTTGTGTATGCTGAAGG + Intergenic
1177930802 21:27280624-27280646 AAATAACATTTTTATCCTAATGG + Intergenic
1178109445 21:29355674-29355696 TAAGACCATCTGTAGCTTGATGG + Intronic
1178169964 21:30029408-30029430 AAATAGGATGTGAATCCTGAAGG + Intergenic
1178461988 21:32810665-32810687 AAATACCACCTAGATGCTGATGG + Intronic
1178713477 21:34941974-34941996 AAATATCATCTGATTCCTCAAGG + Intronic
1179784640 21:43722473-43722495 AAATACCATATGCAGCCTTAGGG + Intronic
1181657422 22:24314822-24314844 AAAAACTATGTGTTTCCTGATGG - Intronic
949788127 3:7763977-7763999 AAGTATCATCTGTCTCCTAACGG - Intergenic
950564335 3:13757924-13757946 AAATATTATTTGTTTCCTGATGG + Intergenic
951021071 3:17781420-17781442 TAAGACCATCTGTAGCTTGATGG - Intronic
951239915 3:20275500-20275522 TAAGACCATCTGTAGCTTGATGG - Intergenic
951486427 3:23216806-23216828 GAATACCATATGCATCTTGATGG + Intronic
952453576 3:33453044-33453066 TAAGACCATCTGTAGCTTGATGG - Intergenic
952554768 3:34519629-34519651 TAAGACCATCTGTAGCTTGATGG + Intergenic
953622400 3:44544264-44544286 TAAGACCATCTGTAGCTTGACGG + Intergenic
955443588 3:58983093-58983115 AAGTACCATCATTATCCTAATGG - Intronic
955786968 3:62551067-62551089 AAGTACCATGAGTATGCTGATGG + Intronic
956842508 3:73153634-73153656 TAAGACCATCTGTAGCTTGATGG + Intergenic
957909746 3:86605938-86605960 AAATAACATCTGCTTCCAGAAGG - Intergenic
958548705 3:95589302-95589324 TAAGACCATCTGTAGCTTGATGG + Intergenic
958620153 3:96548444-96548466 AAATATAATCTGTATTCTGAAGG - Intergenic
959002043 3:100975835-100975857 AAATACCCTCTGGATTCTGAGGG - Intronic
960064047 3:113351840-113351862 TAAGACCATCTGTAGCTTGATGG - Intronic
961718326 3:128874363-128874385 AACTACCATCAATATCCTGATGG - Intergenic
962111750 3:132457918-132457940 AAAAACCTTCTGTATCAGGAGGG + Intronic
962938125 3:140100379-140100401 AATTACCATCTGCATCCCTATGG + Intronic
963021684 3:140878139-140878161 TAAGACCATCTGTAGCTTGATGG - Intergenic
963487468 3:145953408-145953430 AAATGCCATCTTTTTCCTGAAGG - Intergenic
963697288 3:148577362-148577384 TAAGACCATCTGTAGCTTGATGG - Intergenic
963920341 3:150899301-150899323 GAATGCCATCTGTTTCCTGCTGG - Intronic
964702130 3:159580210-159580232 AAATATCAACTTTATCCTGAGGG + Intronic
964976417 3:162625693-162625715 AAATAACATCTATTGCCTGATGG - Intergenic
965139753 3:164818069-164818091 TAAGACCATCTGTAGCTTGATGG - Intergenic
965459795 3:168947937-168947959 AAATATCATCTGTATACTAATGG - Intergenic
967584195 3:191192020-191192042 TAAGACCATCTGTAGCTTGATGG - Intergenic
968231150 3:197005445-197005467 AAATACCATCTATATACAGATGG - Intronic
969327486 4:6452302-6452324 AAAATCCAGCTGTGTCCTGAGGG - Intronic
970503733 4:16705525-16705547 AAATTCAATCTGTGGCCTGAGGG + Intronic
971578989 4:28309610-28309632 TAAGACCATCTGTAGCTTGATGG - Intergenic
971583717 4:28377082-28377104 TATTACTATCTGTATCCTTAAGG + Intronic
971645421 4:29194089-29194111 AAATACCTGCTGGATCCAGAGGG - Intergenic
972577333 4:40364069-40364091 ACACACCATCTGTGTCCTGCTGG - Intergenic
972651401 4:41021118-41021140 TAAGACCATCTGTAGCTTGACGG - Intronic
973750560 4:54015584-54015606 AATTGCCATCTGAATGCTGAAGG + Intronic
974001141 4:56511853-56511875 AAATACCATCTATATGCTAATGG + Intronic
974527401 4:63061513-63061535 TAAGACCATCTGTAGCTTGATGG - Intergenic
974838346 4:67276009-67276031 TAAGACCATCTGTAGCTTGATGG + Intergenic
975392059 4:73832014-73832036 CAATGCCATTTGCATCCTGATGG - Intergenic
975595311 4:76044061-76044083 TAAGACCATCTGTAGCTTGATGG + Intronic
975747700 4:77491147-77491169 AAAAACCATTTATATCCTGGTGG - Intergenic
975778562 4:77817323-77817345 ATATACCTTTTGTATACTGAAGG + Intronic
975852380 4:78585458-78585480 AAGTACCATATGTATGCTCAGGG - Intronic
975989374 4:80241380-80241402 AAATTTCATCTATATGCTGATGG + Intergenic
976174050 4:82334535-82334557 TAAGACCATCTGTAGCTTGATGG + Intergenic
976445002 4:85119638-85119660 AAATGCCATCTATATGCTGATGG + Intergenic
977640724 4:99355471-99355493 TAAGACCATCTGTAGCTTGACGG - Intergenic
977864845 4:102012291-102012313 AAATACAATTTTTAGCCTGACGG - Intronic
977885046 4:102244644-102244666 TAAGACCATCTGTAGCTTGATGG - Intergenic
978778567 4:112526184-112526206 AGAAGCCATCTTTATCCTGAAGG + Intergenic
980870729 4:138608330-138608352 ACACACCATCTGTTTCCTGCTGG + Intergenic
980959577 4:139461589-139461611 CACTACCATCTCTCTCCTGAAGG - Intronic
981279030 4:142935949-142935971 AAATGCCACCTGTATGCTGTAGG - Intergenic
982312414 4:153999917-153999939 ACAAAACATCTGCATCCTGATGG - Intergenic
982543516 4:156705866-156705888 AAATAATATCTCTATCCTCATGG + Intergenic
982701672 4:158664591-158664613 TAAGACCATCTGTAGCTTGATGG - Intergenic
983084620 4:163427885-163427907 TAAGACCATCTGTAGCTTGATGG - Intergenic
983567371 4:169167756-169167778 AAATATATTCTGTATCTTGACGG + Intronic
984917984 4:184740802-184740824 TAAGACCATCTGTAGCTTGACGG - Intergenic
985055756 4:186034383-186034405 AAGTATGATCTGTACCCTGAGGG - Intergenic
985055779 4:186034518-186034540 AAGTATGATCTGTACCCTGAGGG - Intergenic
986792364 5:11174265-11174287 AAATACCATTTAAATGCTGAAGG - Intronic
986903426 5:12465436-12465458 AAATAGTCTCTGTATCATGATGG + Intergenic
987818703 5:22934641-22934663 TAAGACCATCTGTAGCCTAATGG - Intergenic
987818906 5:22936369-22936391 TAAGACCATCTGTAGCCTAATGG + Intergenic
987931135 5:24400439-24400461 TAAGACCATCTGTAGCTTGATGG - Intergenic
987959131 5:24781574-24781596 CAAGACCATCTGTAACCTCACGG + Intergenic
988032603 5:25783482-25783504 ATATTCCCTCTGTATCCTGAGGG + Intergenic
988358331 5:30204424-30204446 TAAGACCATCTGTAGCTTGATGG - Intergenic
988591497 5:32553534-32553556 TAAGACCATCTGTAGCTTGATGG + Intronic
989496670 5:42117001-42117023 TAAGACCATCTGTAGCTTGATGG - Intergenic
989957816 5:50376419-50376441 TAAGACCATCTGTAGCTTGATGG - Intergenic
990037356 5:51338017-51338039 AGATACTATCTGTATCATTAAGG - Intergenic
990076314 5:51849990-51850012 AAATACCATCCATACACTGATGG - Intergenic
990117142 5:52403058-52403080 TAAGACCATCTGTAGCTTGATGG - Intergenic
990367379 5:55084906-55084928 TAAGACCATCTGTAGCTTGATGG + Intergenic
990419471 5:55617357-55617379 TAAGACCATCTGTAGCTTGATGG - Intergenic
990424849 5:55676803-55676825 AAATACCATCTTTATCTTGAAGG - Intronic
992050245 5:72934869-72934891 TAAGACCATCTGTAGCTTGATGG - Intergenic
992617887 5:78562836-78562858 ACACACCACCTGGATCCTGAAGG + Intronic
992877884 5:81075830-81075852 AAATACTATCTGTATGCTAGAGG - Intronic
993138222 5:83997506-83997528 AAATTCCATCTTTATTCTCAGGG - Intronic
993624136 5:90203839-90203861 AGATATCATTCGTATCCTGATGG + Intergenic
993705802 5:91168643-91168665 AAAGATCACCTTTATCCTGAAGG + Intergenic
994230875 5:97309653-97309675 TAAGACCATCTGTAACTTGATGG + Intergenic
995582940 5:113619712-113619734 TAAGACCATCTGTAGCTTGATGG + Intergenic
995674336 5:114645094-114645116 GAATAACATCTGTATTCTGTTGG - Intergenic
996095936 5:119399247-119399269 AAATGCCCTCTGTACCCTGCTGG - Intronic
996681081 5:126228721-126228743 TAAGACCATCTGTAGCTTGATGG - Intergenic
997096788 5:130922772-130922794 AAATACCTTCAATATCCTGAGGG + Intergenic
997636745 5:135414643-135414665 AAAAACCATTTGTACCCTTAAGG + Intergenic
998112208 5:139511035-139511057 TAAGACCATCTGTAGCTTGATGG - Intergenic
998915508 5:147007061-147007083 TAAGACCATCTGTAGCTTGATGG - Intronic
998956637 5:147445573-147445595 AAAAACCATCCCTATCCTCATGG + Intronic
999501373 5:152149826-152149848 ACAGCCCATCTGTGTCCTGAAGG - Intergenic
1000085746 5:157886460-157886482 TAAGACCATCTGTAGCTTGATGG - Intergenic
1000664834 5:163982034-163982056 TAAGACCATCTTTGTCCTGAAGG + Intergenic
1003241954 6:4352815-4352837 AAATTCCATTTGTATCTTCACGG + Intergenic
1003774003 6:9339230-9339252 AAATACCTTGGGAATCCTGAAGG - Intergenic
1003806091 6:9727353-9727375 TAAGACCATCTGTAGCTTGATGG - Intronic
1004318544 6:14613859-14613881 AAAGACAATTTGTATTCTGATGG - Intergenic
1004532192 6:16463878-16463900 TAAGACCATCTGTAGCTTGATGG - Intronic
1007030756 6:38623805-38623827 TAAGACCATCTGTAGCTTGATGG - Intronic
1008270316 6:49482596-49482618 TAAGACCATCTGTAGCTTGATGG + Intronic
1008843623 6:55935484-55935506 AACTATCATCTATATCCTCATGG + Intergenic
1009385106 6:63078168-63078190 TAACACCATCTGTAACTTGATGG + Intergenic
1009407220 6:63327228-63327250 TAAAACCATCTGTAGCTTGATGG + Intergenic
1009471298 6:64030759-64030781 TAAGACCATCTGTAGCTTGATGG - Intronic
1009739160 6:67722636-67722658 TAAGACCATCTGTAGCTTGAAGG - Intergenic
1009873059 6:69472669-69472691 TAAGACCATCTGTAGCTTGATGG - Intergenic
1010018973 6:71138364-71138386 ATATACAATCTGTATTCTCATGG + Intergenic
1010075373 6:71791565-71791587 TAAGACCATCTGTAGCTTGATGG - Intergenic
1010270260 6:73909577-73909599 TAAGACCATCTGTAGCTTGATGG - Intergenic
1010708934 6:79149811-79149833 AAATTACATTTGTATCCTAATGG + Intergenic
1010786072 6:80003376-80003398 AAATACCATCTATATGTTGATGG - Intergenic
1011224962 6:85095680-85095702 TAAGACCATCTGTAGCTTGATGG - Intergenic
1011374202 6:86672741-86672763 TAAGACCATCTGTAGCTTGATGG + Intergenic
1011710177 6:90044972-90044994 AAATACCATCTGCATACTAATGG - Intronic
1012441000 6:99262202-99262224 TAAGACCATCTGTAGCTTGATGG + Intergenic
1012792832 6:103720951-103720973 AGATACCGTGTTTATCCTGAAGG - Intergenic
1013660490 6:112291263-112291285 TAATACAATGTGTTTCCTGAGGG - Intergenic
1013765072 6:113564944-113564966 AAACACCATCTGTCGCCTGTGGG + Intergenic
1013906989 6:115232530-115232552 TAAGACCATCTGTAGCTTGATGG + Intergenic
1013977726 6:116096082-116096104 TAAGACCATCTGTAGCTTGATGG - Intergenic
1013988763 6:116228926-116228948 AACTATCATCTATATACTGATGG + Intronic
1014574674 6:123055736-123055758 AAATACCATCTAAATCCTACAGG - Intronic
1014692874 6:124583633-124583655 ATATACCATATGTCTGCTGATGG - Intronic
1015856209 6:137627123-137627145 AAATACAATCTGCATCCTTAGGG + Intergenic
1016591983 6:145755971-145755993 AAAAACCATATGGATCATGATGG + Intergenic
1016677949 6:146793570-146793592 TAAGACCATCTGTAGCTTGATGG + Intronic
1017673073 6:156785813-156785835 AAAAACCATTAGCATCCTGATGG - Intronic
1019617392 7:1971308-1971330 AAAGACCAACTGTAGCCTGTAGG - Intronic
1019906246 7:4067343-4067365 AAACCCAATCGGTATCCTGAAGG - Intronic
1021232458 7:18102692-18102714 AAATGTCATCTCTATCCTGTAGG - Intronic
1021268392 7:18553888-18553910 AAATGCCGTCTTTATCCTCAAGG + Intronic
1021667475 7:22999794-22999816 AAATATGATCTGTGTCCTCAAGG + Intronic
1021756198 7:23855397-23855419 TAAGACCATCTGTAGCTTGATGG + Intergenic
1022182955 7:27939807-27939829 GAAAACCATCTGAATTCTGAAGG - Intronic
1023077676 7:36499904-36499926 TAAGACCATCTGTAGCTTGATGG + Intergenic
1023768253 7:43531936-43531958 AAATGCCATCTGCATCCTGACGG + Intronic
1024699281 7:51889698-51889720 AAATTCCAACTCTTTCCTGAGGG + Intergenic
1024870154 7:53955576-53955598 TAAGACCATCTGTAGCTTGATGG + Intergenic
1025798005 7:64757867-64757889 TAAGACCATCTGTAGCTTGATGG + Intergenic
1026402538 7:70029427-70029449 AAATACCATCTCCATACTCAAGG - Intronic
1027358094 7:77379310-77379332 TAATACCATCTCTATCATGCAGG + Intronic
1027358100 7:77379377-77379399 TAATACCATCTCTATCATGCAGG - Intronic
1030420782 7:109304074-109304096 TAAGACCATCTGTAGCTTGATGG - Intergenic
1032722805 7:134564606-134564628 TAAGACCATCTGTAGCTTGATGG - Exonic
1033758721 7:144418672-144418694 TAAGACCATCTGTAGCTTGATGG + Intergenic
1033773380 7:144579068-144579090 AAATATCCTCTGTATCCAAAAGG - Intronic
1034022725 7:147662567-147662589 GAATACCATCTGCTACCTGATGG - Intronic
1034579337 7:152028886-152028908 TAAGACCATCTGTAGCTTGATGG + Intronic
1034605028 7:152304596-152304618 AAATGTCATCTTTATCTTGAAGG + Intronic
1035923653 8:3705051-3705073 AAATGACATCTGTTTCCTGGTGG - Intronic
1037015040 8:13893532-13893554 AAATACAATCTATATGCTTATGG + Intergenic
1037991240 8:23322680-23322702 ACATGCCATCTGTTTCCTGCAGG - Intronic
1038430089 8:27493087-27493109 TAAGACCATCTGTAGCTTGATGG + Intronic
1039276505 8:35938609-35938631 TAAGACCATCTGTAGCATGATGG - Intergenic
1039338894 8:36624772-36624794 AAATACCATCCTTTTGCTGATGG - Intergenic
1039751368 8:40481872-40481894 ACATACTGTGTGTATCCTGAAGG - Intergenic
1039998951 8:42560446-42560468 TAAGACCATCTGTAGCTTGACGG + Intergenic
1040528092 8:48241971-48241993 TAAGACCATCTGTAGCTTGATGG - Intergenic
1040649784 8:49434775-49434797 TAAGACCATCTGTAGCTTGATGG - Intergenic
1040667344 8:49650391-49650413 TAAGACCATCTGTAGCTTGATGG + Intergenic
1040732141 8:50461022-50461044 AAATGCAATGTGTATTCTGATGG - Intronic
1040796007 8:51290726-51290748 TAAGACCATCTGTAGCTTGATGG + Intergenic
1041315884 8:56562019-56562041 AAATGCCATCTCTAACCTGTTGG - Intergenic
1041472198 8:58223297-58223319 AAAGATCATCTGTATCTTAATGG + Intergenic
1042291944 8:67178304-67178326 AACACCCACCTGTATCCTGAGGG + Intronic
1042920301 8:73913356-73913378 TAAGACCATCTGTAGCTTGATGG - Intergenic
1043613214 8:82091895-82091917 TAAGACCATCTGTAGCTTGATGG + Intergenic
1044004660 8:86926407-86926429 TAAGACCATCTGTAGCTTGATGG + Intronic
1044456113 8:92394314-92394336 TAAGACCATCTGTAGCTTGATGG + Intergenic
1045187320 8:99852335-99852357 AAATACCATCTATATGTTGATGG - Intronic
1046756211 8:117975161-117975183 AAATACAATCTGTCTTCAGAAGG - Intronic
1049273404 8:141707954-141707976 AAATCCCAGCTGTGTCCTTAAGG + Intergenic
1050053913 9:1632084-1632106 AAATACTATCTACATGCTGATGG + Intergenic
1050655231 9:7820960-7820982 GACAACCATGTGTATCCTGATGG + Intronic
1051358388 9:16260689-16260711 AAATTCCATATGTATGCAGAAGG - Intronic
1051663416 9:19446098-19446120 AAATACCATATGTACACAGATGG - Intronic
1051935735 9:22440624-22440646 TAAGACCATCTGTAGCTTGATGG - Intergenic
1052290042 9:26830021-26830043 TAAGACCATCTGTAGCTTGATGG - Intergenic
1054900825 9:70367852-70367874 AATTACCATGTGTCTCCTCATGG + Intergenic
1057414118 9:94846190-94846212 AAATACCATCTGTATCCTGAAGG - Intronic
1058915650 9:109561795-109561817 TAAGACCATCTGGGTCCTGAAGG + Intergenic
1059974058 9:119697140-119697162 AAAAACCATCTTTTTCCTGGGGG + Intergenic
1203580092 Un_KI270745v1:35708-35730 AAATAGAATCTGTAGGCTGAAGG - Intergenic
1186278846 X:7970667-7970689 AATTACCAACTTTCTCCTGAAGG - Intergenic
1186365858 X:8892717-8892739 AAATACCATCTGGGTTCTCAGGG - Intergenic
1188638856 X:32472628-32472650 AAATACCATCTGTATCACCTTGG - Intronic
1189111469 X:38294522-38294544 AAATACCATCTCTATGTTGATGG + Intronic
1189752620 X:44237961-44237983 AAATACCATCTACATGCTGATGG + Intronic
1189900315 X:45699720-45699742 AACTAAGATCTGTATTCTGATGG + Intergenic
1190895947 X:54618118-54618140 AGTTATCATCTGTATGCTGATGG + Intergenic
1190937533 X:55009870-55009892 AAAGACCATCTATATGCTGATGG + Intronic
1192482211 X:71495290-71495312 TAAGACCATCTGTAGCTTGATGG + Intronic
1192661419 X:73046664-73046686 AAATACCATCTGTGGACTCATGG - Intergenic
1192869795 X:75174373-75174395 TAAGACCATCTGTAGCTTGATGG + Intergenic
1193318222 X:80089633-80089655 AAATAGCATCTTTATTCTTAAGG + Intergenic
1193321054 X:80121890-80121912 TAATACCATCTGTACCTAGATGG - Intergenic
1194809033 X:98367708-98367730 AAATACCAAATGTCTCCAGAAGG + Intergenic
1195230707 X:102844093-102844115 AACTACCTGCTGTCTCCTGAAGG - Intergenic
1195440835 X:104896262-104896284 TAAGACCATCTGTAGCTTGACGG - Intronic
1195552004 X:106181820-106181842 TAAGACCATCTGTAGCTTGATGG + Intronic
1195850640 X:109278377-109278399 TAAGACCATCTGTAGCTTGATGG + Intergenic
1196489574 X:116250311-116250333 TAAGACCATCTGTAGCTTGATGG - Intergenic
1197000419 X:121432300-121432322 TAAGACCATCTGTAGCATGATGG + Intergenic
1197302120 X:124794024-124794046 AAAAACCTTCTGTATCCCAACGG + Intronic
1197485686 X:127048061-127048083 AAATACCATGTGTTTCTTCATGG + Intergenic
1198744842 X:139879182-139879204 AAATAAAATCAGTATCTTGAAGG + Intronic
1199523241 X:148761683-148761705 AGACACCTTCTGTATCCTCATGG + Intronic
1199831901 X:151555881-151555903 TAAGACCATCTGTAGCTTGATGG + Intergenic
1200750945 Y:6943609-6943631 AAATACCATTGGTATCCTTATGG - Intronic
1200880313 Y:8205731-8205753 TAAGACCATCTGTAGCTTGATGG + Intergenic
1200960043 Y:8988178-8988200 TAAGACCATCTGTAGCTTGATGG - Intergenic
1201311328 Y:12600513-12600535 TAAGACCATCTGTAGCCAGATGG + Intergenic
1201430399 Y:13896823-13896845 TAAGACCATCTGTAGCTTGATGG - Intergenic
1201455978 Y:14167158-14167180 TAAGACCATCTGTAGCTTGATGG - Intergenic
1201468999 Y:14314076-14314098 TAAGACCATCTGTAGCTTGATGG - Intergenic
1201495823 Y:14590560-14590582 TAAGACCATCTGTAGCTTGATGG + Intronic
1201515375 Y:14814420-14814442 TAAGACCATCTGTAGCTTGATGG + Intronic
1201572905 Y:15433429-15433451 TAAGACCATCTGTAGCTTGATGG - Intergenic
1201630360 Y:16064534-16064556 AAAAACCATCTAAATCCAGAGGG - Intergenic
1201648490 Y:16261202-16261224 TAAAACCATCTGTAGCTTGATGG + Intergenic
1201650221 Y:16276727-16276749 TAAGACCATCTGTAGCTTGATGG - Intergenic
1201654320 Y:16324099-16324121 TAAAACCATCTGTAGCTTGATGG - Intergenic
1201743613 Y:17348298-17348320 CAAGACCATCTGTAGCTTGATGG + Intergenic
1201989284 Y:20007132-20007154 TAAGACCATCTGTAGCTTGATGG + Intergenic