ID: 1057414121

View in Genome Browser
Species Human (GRCh38)
Location 9:94846225-94846247
Sequence CTGGAGAAGCACAACGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057414118_1057414121 12 Left 1057414118 9:94846190-94846212 CCTTCAGGATACAGATGGTATTT 0: 1
1: 0
2: 2
3: 29
4: 428
Right 1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057414121 Original CRISPR CTGGAGAAGCACAACGTGGA AGG Intronic
No off target data available for this crispr