ID: 1057416179

View in Genome Browser
Species Human (GRCh38)
Location 9:94864040-94864062
Sequence CATCCAAATTGGCCCATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057416179 Original CRISPR CATCCAAATTGGCCCATGTG TGG (reversed) Intronic
901221184 1:7584755-7584777 CTGCCAGATTGCCCCATGTGAGG - Intronic
904456765 1:30652359-30652381 CAGCCTAATTGGCTGATGTGGGG + Intergenic
907283723 1:53367377-53367399 CATCTAAATTATCCCATGGGAGG + Intergenic
910066015 1:83151553-83151575 CATCCAATCTGGCCCCTGTGTGG + Intergenic
912068453 1:105777646-105777668 CATCAAAATGGACCTATGTGGGG - Intergenic
915155184 1:153869834-153869856 AATCCAAATTGGGCCAGGTGTGG + Intronic
919264021 1:195237916-195237938 CATGCTAATTGGTCCATGGGTGG - Intergenic
923306817 1:232696173-232696195 CAGCCAGATTGCCCCAGGTGGGG + Intergenic
1069229522 10:65991709-65991731 CATCCAAATTGGAAAATGGGAGG - Intronic
1070810909 10:79297779-79297801 CATTCAAAGGGGCCCATGGGTGG + Intronic
1071112301 10:82174083-82174105 CATTCAAAATTACCCATGTGTGG + Intronic
1072348566 10:94534415-94534437 TATGCAAAGTGGCCAATGTGAGG - Exonic
1072470202 10:95706719-95706741 CATGCAGATTGGTCCATGGGTGG + Intergenic
1073890633 10:108096933-108096955 CATGCTAATTGGTCCATGGGTGG + Intergenic
1073937658 10:108653201-108653223 CTGCCAATTTGGGCCATGTGTGG + Intergenic
1074028773 10:109663817-109663839 CATGCTAATTGGCCCGTGGGTGG - Intergenic
1077965386 11:7126328-7126350 CATCCAAGTTGGCACATTTATGG + Intergenic
1078963014 11:16301705-16301727 CATCAAACTTGGTCCATATGTGG - Intronic
1080123844 11:28708033-28708055 CAGCCAAATTGGCCAAGGAGAGG - Intergenic
1082687697 11:56260367-56260389 CATGCTGATTGGCCCATGGGTGG + Intergenic
1083066778 11:59932052-59932074 CATGCCAGTTGGCCCATGGGTGG + Intergenic
1084701350 11:70788186-70788208 CATCCACAATGGCCCTGGTGGGG - Intronic
1085435194 11:76493522-76493544 CATGCTAATTGGTCCATGGGCGG - Intronic
1089933128 11:122334517-122334539 CATAAACATTGGCCCAAGTGTGG - Intergenic
1089994896 11:122897143-122897165 CATCTAAATTTGGCCAGGTGCGG - Intronic
1090845821 11:130528941-130528963 CAATCAAATTGGCACATCTGAGG + Intergenic
1096784759 12:54010496-54010518 CTTCGAAATTGGGCCATGAGGGG - Intronic
1098716046 12:73829492-73829514 AATCCAAATAGGCCCATTAGGGG - Intergenic
1101079984 12:101172448-101172470 CTTCCAAATTGGCTCCTGTCTGG - Intronic
1101302774 12:103498501-103498523 CATCCATATTGTCACAAGTGGGG - Intergenic
1102084994 12:110129540-110129562 CAGGCAAATTGGGACATGTGAGG + Intronic
1106158731 13:27181834-27181856 CATCCTAATAGGTCCTTGTGAGG - Intergenic
1108464081 13:50696747-50696769 CATGCTGATTGGCCCATGGGTGG + Intronic
1109055791 13:57546860-57546882 AATCCAAACTGGCCAGTGTGGGG - Intergenic
1111268841 13:85853844-85853866 CATGCTGATTGGCCCATGGGTGG - Intergenic
1111274879 13:85935581-85935603 CATGCTGATTGGCCCATGGGTGG - Intergenic
1117930893 14:60839228-60839250 CATGCTAATTGGTCCATGGGTGG - Intronic
1121528008 14:94632952-94632974 CATGCGAATTGGTCCATGGGCGG + Intergenic
1124657218 15:31518091-31518113 CATCCAAACTGGTTCATTTGGGG - Intronic
1126066715 15:44831332-44831354 CATCCTCATTGGGCCATCTGAGG - Intergenic
1126093160 15:45069543-45069565 CATCCTTATTGGGCCATCTGAGG + Intronic
1127121373 15:55774991-55775013 CTTTCAAATTGGCCCAAGAGTGG + Intergenic
1128317265 15:66668935-66668957 CTCCCAAATGGGCCCATGGGTGG - Intronic
1128790695 15:70431727-70431749 CATGCCAATTGGTCCATGGGCGG + Intergenic
1129600954 15:76997852-76997874 CAGCCAGCTTGGCCCATGTCTGG + Intronic
1130660462 15:85827817-85827839 CAGCCAAATAGGGCCAGGTGCGG - Intergenic
1132137062 15:99351666-99351688 CATCCACCTTTGCCCATGGGAGG + Intronic
1138393706 16:56688734-56688756 CATCCACATTGGGCAATGTCAGG - Intronic
1139012528 16:62649843-62649865 CATGCTAATTGGTCCATGGGTGG - Intergenic
1140236344 16:73162374-73162396 CAGCCAAAGAGTCCCATGTGGGG - Intergenic
1141099797 16:81188950-81188972 CATCCAACCTGGTCCATATGTGG - Intergenic
1149085467 17:52710321-52710343 CATGCAGATTGGTCCATGGGTGG - Intergenic
1150592401 17:66575286-66575308 CTTACAAATTGGGCCAGGTGTGG + Intronic
1159030940 18:63231107-63231129 CTTCCTAATTTGCCAATGTGGGG - Intronic
1162263662 19:9552590-9552612 CATGCCAATTGGCCCATGGGTGG + Intergenic
1162610609 19:11747279-11747301 CATCCAATTTGGAAAATGTGTGG - Intergenic
1167012258 19:46816366-46816388 CATCCTCAAAGGCCCATGTGGGG + Intergenic
1168408785 19:56125491-56125513 CACCCAAGTTGGCCCATCAGTGG + Intergenic
926192403 2:10738666-10738688 CATCCAAAAAGGACCATGGGAGG - Intronic
926541273 2:14183246-14183268 CATGCTGATTGGCCCATGAGCGG - Intergenic
926859274 2:17291745-17291767 CATACCAATTGGTCCATGGGTGG + Intergenic
932105567 2:68938034-68938056 GATCCTAATTGGCTCATGTGGGG - Intergenic
932868849 2:75375891-75375913 TTTCAAAATTGGCCCATATGGGG + Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
934099254 2:88636429-88636451 CATCCATATTGGCCCAGGACTGG - Intergenic
936347872 2:111688924-111688946 AATCCAAACCGGCCCATGTCAGG - Intergenic
938901854 2:135805180-135805202 CAAGCACATTGGTCCATGTGTGG + Intronic
939102774 2:137914665-137914687 CATCAAAAATGACCCAGGTGCGG + Intergenic
940062455 2:149587613-149587635 CCTCCAAATTTGCCCGTGTTAGG - Intronic
941074125 2:160988064-160988086 CATCAAAAATGTTCCATGTGGGG + Intergenic
941998887 2:171626952-171626974 CATGCTAATTGGCCCATGGGTGG - Intergenic
942763838 2:179430719-179430741 CTTCCAATTTTACCCATGTGTGG - Intergenic
943029561 2:182669939-182669961 GCTCCAAATGGGCCCGTGTGTGG - Intergenic
943219240 2:185083483-185083505 CATCAAAATTGCCCCATAGGAGG - Intergenic
943242049 2:185397266-185397288 CATGCAGATTGGTCCATGGGTGG + Intergenic
944217357 2:197269732-197269754 CACTCAAAGTGGCCCATGGGAGG + Intronic
945167947 2:206966318-206966340 CATGCTAACTGGTCCATGTGGGG - Intronic
945612279 2:212018833-212018855 CATTCAAATTGGGCAATCTGGGG + Intronic
945929229 2:215838542-215838564 CATTCAAACTGGCCCCTATGTGG - Intergenic
946083775 2:217150663-217150685 AATCCAGAGTGGCCCAGGTGTGG + Intergenic
947278026 2:228416926-228416948 CATGCTGATTGGCCCATGGGTGG + Intergenic
947863804 2:233381941-233381963 TATGCAAATTGGGCCAGGTGCGG + Intronic
1172676702 20:36677422-36677444 CATGCTGATTGGCCCATGGGCGG - Intronic
1173328733 20:42056740-42056762 CATCCAAATTGGTACATCTTTGG + Intergenic
1177632129 21:23742408-23742430 CATGCAAATCGGTCCATGGGTGG - Intergenic
1178402785 21:32301250-32301272 CATCCTAATTGGGCCAGGCGTGG - Intronic
1184865811 22:47201465-47201487 CATGCCAATTGGTCCATGGGTGG + Intergenic
1185293316 22:50039834-50039856 CATCCACGCTGGCACATGTGAGG - Intronic
1185293357 22:50040072-50040094 CATCCATGCTGGCACATGTGAGG - Intronic
1185293366 22:50040131-50040153 CATCCACACTGGCACATGTGAGG - Intronic
1185293398 22:50040326-50040348 CGTCCACACTGGCACATGTGAGG - Intronic
950562488 3:13742785-13742807 CATACTAACTGGCCCATGGGAGG - Intergenic
950982690 3:17325610-17325632 CATCCATATTGGGCCAGGCGCGG - Intronic
956005417 3:64773515-64773537 CATTCAAAAGGGGCCATGTGAGG - Intergenic
956023171 3:64953967-64953989 CATCCAAAGGGGACCATTTGAGG - Intergenic
957665317 3:83218448-83218470 CATGCAGATTGGTCCATGGGTGG + Intergenic
959193736 3:103149928-103149950 AGTCCAAATTGGTCCATGTGTGG - Intergenic
959684717 3:109131946-109131968 CATCAAAATTGTTCCTTGTGTGG - Intergenic
961399978 3:126633022-126633044 AATTCAAATTGGCCCATGTAAGG + Intronic
961577429 3:127849290-127849312 CATCCACATGGTCCCATGTGGGG + Intergenic
961718354 3:128874652-128874674 CATCCTACTTGGCCCATCTTTGG - Intergenic
962824532 3:139088487-139088509 CATGCCATTTGGCCCATGGGTGG + Intronic
964255036 3:154766469-154766491 CATGCCAGTTGGCCCATGAGTGG + Intergenic
964448849 3:156790150-156790172 CACCCAAGTTGGGCCATGTCTGG - Intergenic
968832503 4:2940339-2940361 CATCCACATGGGCCCAGGAGTGG - Intronic
970993454 4:22238648-22238670 CACCCAAGGTGGCCCAGGTGGGG + Intergenic
976948754 4:90802680-90802702 CATCCAAATAGGTCCATGGGAGG - Intronic
986064790 5:4224451-4224473 CATCCAAAATGGGCACTGTGGGG - Intergenic
987835173 5:23151157-23151179 CAACCAGATGGTCCCATGTGGGG - Intergenic
989549067 5:42711342-42711364 CATGTAAATTGGCTCATCTGAGG - Exonic
989572640 5:42959240-42959262 CTACCTCATTGGCCCATGTGGGG + Intergenic
990491156 5:56304166-56304188 AATCCAAATGGTCCCAGGTGTGG + Intergenic
999859923 5:155633874-155633896 CATGCCAATTGGCTCATGGGTGG - Intergenic
1002693678 5:181070196-181070218 CATGCCGATTGGCCCATGCGTGG + Intergenic
1003438997 6:6122207-6122229 CATGCCAATTGGTCCATGTGTGG - Intergenic
1003987198 6:11448739-11448761 CATCCATATTGTAGCATGTGTGG + Intergenic
1006520788 6:34569981-34570003 CATTCAAGTTGGCCCCTGTATGG - Intergenic
1010351232 6:74877108-74877130 CATTTTAATTTGCCCATGTGTGG - Intergenic
1012135498 6:95551360-95551382 CATCCAGTTTGTCCCATCTGTGG - Intergenic
1013545297 6:111150951-111150973 CATCTAAATTTGCAAATGTGAGG + Intronic
1016461157 6:144281453-144281475 CATCCAAAGTGGCCTATTTAAGG + Intergenic
1018572028 6:165222051-165222073 CGACCACACTGGCCCATGTGGGG - Intergenic
1020678046 7:11203458-11203480 CATCCACATTCCCCCGTGTGAGG - Intergenic
1021500764 7:21329964-21329986 CATGCAGATTGGTCCATGGGTGG + Intergenic
1021885230 7:25131229-25131251 CATCTAGATGGTCCCATGTGGGG - Intergenic
1023444784 7:40220160-40220182 CATCAAAACTGGCCAAAGTGGGG - Intronic
1023790437 7:43749642-43749664 CATGCCAATTGGTCCATGGGTGG + Intergenic
1026274998 7:68869000-68869022 CATCTTAATTGGCCCATGTTAGG - Intergenic
1026860934 7:73788349-73788371 CATTAAAATTGGGCCAGGTGAGG + Intergenic
1027278095 7:76583222-76583244 CATCCAATCTGGCCCCTGTGTGG - Intergenic
1031248635 7:119350657-119350679 CATGCCAATTGGTCCATGGGTGG - Intergenic
1034481222 7:151321418-151321440 CATGCCAATTGGTCCATGGGCGG - Intergenic
1035434546 7:158849842-158849864 CATCCTGATTGGTCCATGGGTGG + Intergenic
1036725197 8:11214374-11214396 CATCAAAAAGAGCCCATGTGTGG - Intergenic
1043596052 8:81886057-81886079 CATGCAAATTTTCCCATTTGTGG - Intergenic
1047665344 8:127085766-127085788 CATCCAAATAGCCCCAAGAGTGG - Intergenic
1052012001 9:23421607-23421629 CATCAAATTTGGCCCATGAGAGG - Intergenic
1052444181 9:28538676-28538698 CTTCCAAATTCTGCCATGTGAGG - Intronic
1052494863 9:29213159-29213181 CAGCCAAGTTGGCCCAGGAGGGG - Intergenic
1056674672 9:88665169-88665191 CATCTAAATGGTCCCATCTGGGG - Intergenic
1057132182 9:92661814-92661836 CATGCCAACTGCCCCATGTGAGG + Intronic
1057416179 9:94864040-94864062 CATCCAAATTGGCCCATGTGTGG - Intronic
1060531340 9:124348660-124348682 CATCCAAAGTGGCCAATGGATGG + Intronic
1061187031 9:129060751-129060773 CATCCAAATTCTCCCATCAGAGG - Intronic
1186622104 X:11252401-11252423 CTCACAAAGTGGCCCATGTGGGG - Intronic
1187557723 X:20368020-20368042 CAACCAGATGGTCCCATGTGAGG - Intergenic
1187871214 X:23766807-23766829 CATGCTGATTGGCCCATGGGTGG + Intergenic
1190440170 X:50469255-50469277 CATTCCAATTGGCCCTGGTGCGG + Intronic
1201990929 Y:20024584-20024606 CATCAAAAATGGCACATGAGAGG - Intergenic