ID: 1057420990

View in Genome Browser
Species Human (GRCh38)
Location 9:94912254-94912276
Sequence TCTTAGCTTTGTTAGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057420986_1057420990 14 Left 1057420986 9:94912217-94912239 CCGAGTTCTTAAAAACCACTAGA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG No data
1057420987_1057420990 -1 Left 1057420987 9:94912232-94912254 CCACTAGAATAGATAGTACCGCT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG No data
1057420985_1057420990 21 Left 1057420985 9:94912210-94912232 CCAAAGACCGAGTTCTTAAAAAC 0: 1
1: 0
2: 1
3: 14
4: 257
Right 1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG No data
1057420983_1057420990 23 Left 1057420983 9:94912208-94912230 CCCCAAAGACCGAGTTCTTAAAA 0: 1
1: 0
2: 2
3: 22
4: 198
Right 1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG No data
1057420984_1057420990 22 Left 1057420984 9:94912209-94912231 CCCAAAGACCGAGTTCTTAAAAA 0: 1
1: 0
2: 0
3: 17
4: 265
Right 1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057420990 Original CRISPR TCTTAGCTTTGTTAGGTGTT TGG Intronic
No off target data available for this crispr