ID: 1057421634

View in Genome Browser
Species Human (GRCh38)
Location 9:94917654-94917676
Sequence CAGTGATACTATAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057421634 Original CRISPR CAGTGATACTATAGGGCAGT GGG (reversed) Intronic
901904517 1:12396225-12396247 CAGTGTGACTGTAGGGCCGTTGG + Intronic
904862009 1:33545621-33545643 CAGTGATAGTATTAGGAAGTGGG - Intronic
911175176 1:94811207-94811229 CAGTGATACTACATGGCTGGGGG + Intergenic
911353495 1:96786245-96786267 GAGAGATACTCTAAGGCAGTTGG + Intronic
915994424 1:160549197-160549219 GAGTGATCCTATAAGGCAATAGG - Intronic
921060558 1:211580447-211580469 CAGTAGTAATCTAGGGCAGTGGG - Intergenic
922441062 1:225655025-225655047 CACTGCTTCTATAGGGCTGTTGG - Intergenic
1070495262 10:77015589-77015611 CAGTGATATCATAAGGCGGTTGG - Intronic
1070974941 10:80599159-80599181 CAGTGATACTAAAATGCTGTAGG + Intronic
1072680985 10:97506333-97506355 TTGTGAGACTCTAGGGCAGTGGG + Intronic
1079604649 11:22349666-22349688 CAGTGGTAGCATATGGCAGTAGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1086996297 11:93360084-93360106 CAGTGATACTATAGTGGGGGTGG - Intronic
1097992254 12:65848434-65848456 AAGTGATACATTAAGGCAGTAGG + Intronic
1099963563 12:89420544-89420566 CAGATATAGCATAGGGCAGTGGG - Exonic
1100032993 12:90215698-90215720 CATTGGTACTTTAGGGCACTGGG + Intergenic
1100102853 12:91130515-91130537 CTTGGATACTAGAGGGCAGTGGG - Intergenic
1101795196 12:107966609-107966631 CAGTGATTCTAATGTGCAGTCGG - Intergenic
1103771888 12:123333323-123333345 CTGTGATATTATTGGACAGTGGG - Intronic
1106146142 13:27051585-27051607 CAGTGAGAATATAGGACATTTGG - Intergenic
1110343169 13:74415835-74415857 TAGTGATACTATAGCACAGAAGG - Intergenic
1111342672 13:86908691-86908713 CAGTTATTCTGTAGGACAGTAGG + Intergenic
1111356992 13:87119518-87119540 CAGAGAAACTTTAGCGCAGTGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112130112 13:96514209-96514231 CAGTGATACCAGCGTGCAGTAGG + Intronic
1123805867 15:23872569-23872591 CAGTGATATTATGAGGCATTTGG + Intergenic
1129255144 15:74330139-74330161 CAGGGTTGCTATGGGGCAGTGGG + Intronic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1132228600 15:100164665-100164687 AAGTCATACTATAAGGCAGGTGG + Intronic
1135256081 16:20942525-20942547 CAGTGATACTTAATGGCACTAGG + Intronic
1136060827 16:27725244-27725266 CAGTGATCCTATGAGGCAGGTGG + Intronic
1137867005 16:51908508-51908530 ATGTGATACTACAGTGCAGTGGG - Intergenic
1138726553 16:59146829-59146851 CAGATATTCTAGAGGGCAGTGGG - Intergenic
1143328908 17:6119965-6119987 CTGTGAAACTGCAGGGCAGTAGG - Intronic
1145735989 17:27232021-27232043 CTGGGATACTGTAGGGCAGAAGG + Intergenic
1151380575 17:73723007-73723029 CAGTGAGACTGTACTGCAGTTGG + Intergenic
1151739621 17:75971362-75971384 CAGAGATCCTATATGGCTGTGGG - Intronic
1153165735 18:2260084-2260106 CACTGAAACTATAGGTCACTGGG - Intergenic
1153688967 18:7572728-7572750 AAGTGAAACTATAGGAAAGTTGG - Intronic
1163816484 19:19468147-19468169 CAGTGAGACTGTATGGCATTTGG + Intronic
1166814734 19:45536762-45536784 AAGTGACACTGTAGTGCAGTGGG + Intronic
1168366908 19:55796082-55796104 CAGTGATATAAGAGTGCAGTTGG + Exonic
928445808 2:31332522-31332544 CTGTGCTACTAAAGGGCCGTAGG + Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
931594317 2:63924797-63924819 GAGTGACATTATAGAGCAGTAGG + Intronic
931639521 2:64369741-64369763 CATTGATAGTAAAGGCCAGTTGG + Intergenic
932352395 2:71043255-71043277 CATTGCTCCTAAAGGGCAGTGGG + Intergenic
933583474 2:84153703-84153725 CAGTCAGACTATAGCTCAGTTGG - Intergenic
933608875 2:84413606-84413628 CTGAGTTACTTTAGGGCAGTTGG - Intergenic
937391085 2:121487152-121487174 CAGTGCTTATTTAGGGCAGTGGG - Intronic
941246684 2:163106611-163106633 TATTGATACTATTGGGAAGTAGG - Intergenic
945666243 2:212747173-212747195 CAGTGATATTATAGTGCAGAAGG - Intergenic
946422952 2:219575204-219575226 CAGTGCTACTCTGTGGCAGTTGG - Exonic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1173710259 20:45149401-45149423 CAGAGATACTACAAGGCAGTAGG + Intergenic
1174527753 20:51187437-51187459 CAGTGATACTATTGCCCAGATGG + Intergenic
1177224057 21:18231080-18231102 TAGTGATACTATAGTCCATTGGG + Intronic
1178118212 21:29439188-29439210 CAGTTTTACTTTAGGGCATTAGG - Intronic
1179330530 21:40396767-40396789 CATTAATTCTATAGGACAGTTGG - Intronic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1184080734 22:42218044-42218066 CAGTGAATCTGCAGGGCAGTAGG + Intronic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
952139800 3:30465995-30466017 GACTTATACTTTAGGGCAGTGGG + Intergenic
956389089 3:68752633-68752655 GAGTTATATTATAGGGCAGTTGG - Intronic
957853768 3:85846336-85846358 CAGTCATTCTAGAGGACAGTGGG - Intronic
958075984 3:88679032-88679054 CACTGAAACCATGGGGCAGTTGG + Intergenic
963060389 3:141220629-141220651 TAGTACTCCTATAGGGCAGTGGG - Intergenic
969241252 4:5899734-5899756 CAGTGATTCTAATGGGCAGCTGG - Intronic
969560409 4:7943212-7943234 CAGTGAAGTTCTAGGGCAGTTGG + Intergenic
972902346 4:43700455-43700477 CAGTCATCCTTCAGGGCAGTGGG + Intergenic
973222351 4:47742959-47742981 CAGTGATATTACAGTGCAGAGGG + Intronic
973856842 4:55019949-55019971 CAGTGTCACTGTAGAGCAGTGGG - Intergenic
975710985 4:77158847-77158869 GAGTGATACTTTAGAGAAGTGGG + Intronic
977807789 4:101323303-101323325 CTGTGCTACTATAGGGCTTTGGG + Intronic
978784389 4:112593305-112593327 CAGTGAAAGTATAGTGGAGTTGG - Intronic
981042714 4:140238130-140238152 CAGTCAGACAATAGGCCAGTCGG - Intergenic
988965727 5:36415836-36415858 CAGTGGTTGTATAGGGCAGGAGG + Intergenic
991299087 5:65111310-65111332 CAGTGAAGCTAAAGGGTAGTGGG - Intergenic
992882754 5:81126950-81126972 CAGAGATAATACAGGGCATTTGG + Intronic
994051274 5:95365499-95365521 CTGTGGTAGTATGGGGCAGTGGG + Intergenic
994911068 5:105908444-105908466 CACTAATTCTATAGAGCAGTTGG - Intergenic
995126509 5:108581990-108582012 CAGTGATAGTATAAGGAAGTGGG - Intergenic
999080188 5:148836222-148836244 CAGTGATGCTATTGGGAGGTTGG - Intergenic
1010242095 6:73625712-73625734 TGGTGATTCTATAGAGCAGTGGG + Intronic
1011340682 6:86309717-86309739 CAGAGATATTACAGGGCAGGAGG + Intergenic
1015592873 6:134839228-134839250 CAGTACTTCCATAGGGCAGTGGG - Intergenic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1021147989 7:17112635-17112657 AAGTGATACTATGGTGCAGCTGG - Intergenic
1025907420 7:65798539-65798561 CAGTAATACAATAGGGAACTGGG + Intergenic
1034468448 7:151243410-151243432 AAGTGGTACTATAGAGCTGTGGG - Intronic
1043054946 8:75425657-75425679 CAGTGATACTTTTGGGTAGTTGG - Intronic
1043242624 8:77954807-77954829 CAGAGAGACTATATGACAGTTGG - Intergenic
1047392874 8:124467981-124468003 AAGTGACACTAGAGTGCAGTGGG - Intergenic
1050180078 9:2912768-2912790 CAGAGGTACTACAGGGCTGTAGG + Intergenic
1057421634 9:94917654-94917676 CAGTGATACTATAGGGCAGTGGG - Intronic
1058364204 9:104188439-104188461 CAGTGATACCATAGGGTGTTGGG + Intergenic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1061735122 9:132649955-132649977 CAGGGATGCTATAGAGCATTGGG + Intronic
1190434413 X:50409040-50409062 CTGTGATTCTATATGGAAGTAGG + Intronic
1191768135 X:64723942-64723964 CAGAGAAACTATATGGCACTGGG + Intergenic
1192070575 X:67936245-67936267 CAGTGAACCTATTGGGAAGTGGG + Intergenic
1193955363 X:87853463-87853485 CAGTGATATTATAGTGCATTAGG + Intergenic
1197586856 X:128358835-128358857 CAGTGTCACAATAGGGCACTGGG + Intergenic
1198278570 X:135120286-135120308 CAGAGACACTATAGAGCAGTGGG - Intergenic
1198292391 X:135252230-135252252 CAGAGACACTACAGAGCAGTGGG + Intronic
1198298302 X:135308498-135308520 CAGAGAAACTATAGAGCAGTGGG + Intronic
1198771977 X:140140087-140140109 CATTGAAGCTATAGGTCAGTTGG - Intergenic
1199136101 X:144254981-144255003 CAGTGAAAATATAGAGCACTGGG - Intergenic