ID: 1057422744

View in Genome Browser
Species Human (GRCh38)
Location 9:94925673-94925695
Sequence GACACTGATGTGCACACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057422744_1057422745 -10 Left 1057422744 9:94925673-94925695 CCAGCAGTGTGCACATCAGTGTC 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1057422745 9:94925686-94925708 CATCAGTGTCCCCTGCCACATGG No data
1057422744_1057422751 7 Left 1057422744 9:94925673-94925695 CCAGCAGTGTGCACATCAGTGTC 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1057422751 9:94925703-94925725 ACATGGAGTCCTGTGAGGAGAGG No data
1057422744_1057422754 30 Left 1057422744 9:94925673-94925695 CCAGCAGTGTGCACATCAGTGTC 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1057422754 9:94925726-94925748 CCACATGATAGATACAGAAAAGG No data
1057422744_1057422749 2 Left 1057422744 9:94925673-94925695 CCAGCAGTGTGCACATCAGTGTC 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1057422749 9:94925698-94925720 CTGCCACATGGAGTCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057422744 Original CRISPR GACACTGATGTGCACACTGC TGG (reversed) Intronic
900798712 1:4724891-4724913 GTCACTGATGCCCACACTGGAGG + Intronic
900871188 1:5304556-5304578 GACACTCATGTGCAAGCTCCTGG + Intergenic
900955339 1:5883247-5883269 AGCACTGATGTTCACACTCCGGG + Intronic
902726125 1:18337430-18337452 GTCTCTGATGTGCCCACTCCTGG + Intronic
906253151 1:44326970-44326992 GACACAGGTGTGCACACCTCAGG - Intronic
906439563 1:45829460-45829482 CACACTGCTATGTACACTGCTGG - Exonic
907799730 1:57752625-57752647 CACACTGATGAGCAGACTGGTGG + Intronic
916342228 1:163749377-163749399 GACACTGATGTATACACATCAGG + Intergenic
917491487 1:175502264-175502286 AACTCTGATGTGCAGAATGCTGG + Intronic
919207023 1:194431316-194431338 GCCAGGGCTGTGCACACTGCTGG - Intergenic
919847050 1:201648874-201648896 GACACGGCTGTCCACGCTGCCGG - Exonic
922270430 1:224027707-224027729 TACACTGATCTGCACACAGGAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1065184887 10:23162084-23162106 GTCCCTGATGGGCACACTCCAGG - Intergenic
1065277568 10:24100259-24100281 GAAACAGATGTGCAACCTGCTGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1065839732 10:29692465-29692487 GACACTGATGATCTCATTGCAGG - Intronic
1066471584 10:35702864-35702886 GACACAGATTTGCACACTGATGG - Intergenic
1067901608 10:50247510-50247532 GACCCTGCTGTGCCTACTGCTGG + Intronic
1076677647 10:132155751-132155773 CGCAGTCATGTGCACACTGCTGG - Intronic
1077426394 11:2480744-2480766 AACACTGACATGCACACTACAGG - Intronic
1077765201 11:5151620-5151642 GACACAGATGTGAGCAATGCAGG + Exonic
1078436080 11:11327038-11327060 GGCACTCATATGCACACTCCTGG + Intronic
1081801435 11:45862180-45862202 GATACTGATATCCACACAGCAGG + Intronic
1083088277 11:60173093-60173115 GATGCTGATTTGCACTCTGCTGG - Exonic
1088534048 11:110840476-110840498 GAGACTGATGTGGCCTCTGCAGG + Intergenic
1089741729 11:120589223-120589245 GACACTCATGCTCACACTGCTGG + Intronic
1091650437 12:2305135-2305157 CACACAGATGCACACACTGCAGG + Intronic
1096975476 12:55697262-55697284 GACCCTTAGGTCCACACTGCGGG + Exonic
1100708395 12:97227450-97227472 GGCACTGATGTACTCACTTCTGG - Intergenic
1101648520 12:106653696-106653718 GACACTGATCTGCTGACTGAAGG - Intronic
1102157866 12:110744871-110744893 GCCAGGGATGTGAACACTGCTGG - Intergenic
1104137483 12:125954218-125954240 GACACTGATGTGGTCCCTGGTGG + Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1108514883 13:51191684-51191706 GACATTGATCTTCCCACTGCTGG + Intergenic
1113474817 13:110572709-110572731 GTCTCTGCTGTCCACACTGCAGG - Intergenic
1113533830 13:111048779-111048801 GACAAGGATGTGCTCACTGATGG - Intergenic
1113630095 13:111876417-111876439 GACACTGCGGTGCACACAGAGGG + Intergenic
1114803343 14:25804867-25804889 AATACTGATGACCACACTGCTGG + Intergenic
1116076265 14:40114748-40114770 AACACTGATATGGCCACTGCTGG + Intergenic
1117033970 14:51707548-51707570 GAGGCTGATATGAACACTGCTGG - Intronic
1117046635 14:51819070-51819092 GACACAGATCTGCTCACTGCAGG - Intergenic
1117257641 14:53995182-53995204 GGCACTGATTTTCACACTGAGGG + Intergenic
1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG + Intronic
1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG + Intergenic
1122244276 14:100390726-100390748 GGCACAGATCTGCACACTGGTGG - Intronic
1124437424 15:29662624-29662646 GACAGAGTTGTGAACACTGCTGG - Intergenic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1130745672 15:86651237-86651259 GACTCTGATGTGGGCCCTGCAGG + Intronic
1133004340 16:2869991-2870013 GACTGTGATGTACACACTGGGGG + Intergenic
1134869452 16:17638582-17638604 GACCCTGATGTGCACATAGTAGG - Intergenic
1136013607 16:27381199-27381221 GACCCAGATGTGCACACCACAGG - Intergenic
1138976449 16:62214054-62214076 GACACTGATGGGCACAGGTCTGG + Intergenic
1139523247 16:67497369-67497391 GACACTTATGTGGACACCCCAGG + Intergenic
1141673540 16:85505554-85505576 GACACTGATGCCCACACAGGTGG - Intergenic
1142121566 16:88389048-88389070 GCCACTGAAGCGCACACTGTAGG - Intergenic
1142639253 17:1276190-1276212 GACAGGGATGTGAACAGTGCGGG - Intergenic
1144731646 17:17529533-17529555 GGCACTAGTGTGCTCACTGCAGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1147598486 17:41731950-41731972 CACAGGGATGAGCACACTGCAGG + Exonic
1149658371 17:58322109-58322131 GACACTGATGAGCACAGTGGTGG - Intronic
1151883846 17:76911799-76911821 AACAATGGAGTGCACACTGCAGG + Intronic
1154150942 18:11905930-11905952 AGCACTGAGGTGGACACTGCGGG - Intronic
1155446697 18:25920651-25920673 GCCAGTGATGTGTACACTGGGGG - Intergenic
1156490648 18:37493965-37493987 GACAGAGATGTGCACAGAGCTGG + Intronic
1159900148 18:74038020-74038042 GGCAGTGATGAGAACACTGCAGG - Intergenic
1160686951 19:441350-441372 GCCACAGATGCACACACTGCTGG + Intronic
1165750321 19:38255706-38255728 GACACAGATGTGCACAGTGAAGG - Intronic
1166269339 19:41704348-41704370 GACACTGGTGTTCCCACTCCTGG - Intronic
1168633356 19:57974694-57974716 CTCACTAATCTGCACACTGCAGG - Intergenic
924992932 2:329442-329464 GACACTGATGTCCACTCATCTGG - Intergenic
925588529 2:5487340-5487362 GACTCAGATGTGCTCACTTCAGG + Intergenic
926309026 2:11661085-11661107 CTCACTGATGTTGACACTGCTGG - Intronic
927469046 2:23358559-23358581 ACCACTGAAGTGCCCACTGCTGG - Intergenic
929388758 2:41443053-41443075 GGCACTCAAGTTCACACTGCTGG + Intergenic
931632507 2:64313528-64313550 CACACTGCTGTCCTCACTGCTGG - Intergenic
932731669 2:74226214-74226236 GAACTTGAAGTGCACACTGCTGG - Intronic
935221905 2:101022401-101022423 GAAACAGGTGTGCAAACTGCCGG + Exonic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
936817995 2:116484212-116484234 AACACTGTTGTGCAGTCTGCAGG - Intergenic
941020098 2:160398569-160398591 GAAACTGAGCTGGACACTGCAGG + Intronic
944136509 2:196405633-196405655 GACATTGATGTGCACAAGGAGGG - Intronic
946800435 2:223409815-223409837 AACACTTATGTGCTCAGTGCTGG - Intergenic
947667254 2:231914159-231914181 GACACTGAGGGGCCCAGTGCTGG - Intergenic
948397011 2:237652310-237652332 GTCAATGATGTGAACACGGCTGG + Intronic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
948965455 2:241376230-241376252 GACACTGCAGTGCCCACTTCTGG - Intronic
1170095241 20:12638916-12638938 GACTCTAATGTGATCACTGCTGG + Intergenic
1170455138 20:16525463-16525485 GACACTGATGTTGACATTTCAGG - Intronic
1171815769 20:29784827-29784849 AAGACGGATGTGCGCACTGCTGG - Intergenic
1171963662 20:31514042-31514064 GACACTGAGGTGAACAATACAGG - Intergenic
1172564007 20:35914039-35914061 GTCACTGATCTCCTCACTGCAGG - Exonic
1172781418 20:37438886-37438908 TACACTCATGCGCACACTGCAGG - Intergenic
1173404610 20:42753716-42753738 GACACTGATTTGTCCTCTGCTGG - Intronic
1174561623 20:51434602-51434624 GACACAGCTGTGAACACTACAGG - Intronic
1178599418 21:33983236-33983258 CACACTCATGTCCTCACTGCAGG - Intergenic
1179296289 21:40065779-40065801 AACACTGATACCCACACTGCAGG + Intronic
1179320507 21:40286654-40286676 CACACTGCTGAACACACTGCAGG - Intronic
1179798677 21:43800251-43800273 CACACTGCGGGGCACACTGCAGG - Intronic
1179955462 21:44735785-44735807 GACACTGTCTTGCACCCTGCAGG - Intergenic
1180319220 22:11305394-11305416 AAGACGGATGTGCGCACTGCTGG - Intergenic
1182121249 22:27788302-27788324 GATCCTGATGTGGACACTGTAGG - Intronic
1184159855 22:42691782-42691804 GACACTGAGGAGCCCACCGCCGG - Intergenic
950650364 3:14403217-14403239 AACACACATGTGCACGCTGCTGG - Intronic
950681528 3:14588519-14588541 GCCACTGATGTGTACCCTTCTGG + Intergenic
955948567 3:64219341-64219363 GAACCTGATGTGCACACAACTGG + Intronic
957117929 3:76050368-76050390 CACACTGAAGGGGACACTGCTGG + Intronic
958655311 3:96993689-96993711 GAGTCTAATGTGGACACTGCTGG + Intronic
959096366 3:101960951-101960973 GCCATTGCTGTGCACACTGATGG + Intergenic
959430537 3:106250004-106250026 CACAGAGATTTGCACACTGCAGG - Intergenic
959634144 3:108543410-108543432 GACACTGATATGCACATTACTGG + Intergenic
960932002 3:122861670-122861692 GCCTCTGATGTGTAAACTGCTGG - Intronic
961585416 3:127918204-127918226 GTCAATGATGAGCACACTGCGGG - Intronic
967766806 3:193289935-193289957 TGCACTGATCTGCACAATGCAGG + Exonic
967770647 3:193330346-193330368 GCCACTGCTGTGTACAATGCTGG - Intronic
968760340 4:2439583-2439605 GTCATTGATGTGTACAGTGCTGG - Intronic
972696035 4:41447719-41447741 AACAGTGATTTTCACACTGCTGG + Intronic
975862491 4:78692242-78692264 CACACAGATATGCAAACTGCTGG + Intergenic
980791994 4:137632272-137632294 GGCACTGCTGGGCACAGTGCTGG - Intergenic
981767972 4:148273860-148273882 GACCCCCCTGTGCACACTGCAGG - Intronic
981823381 4:148912200-148912222 GACACTAGTGTGAATACTGCTGG - Intergenic
985555370 5:555456-555478 GGGCCTGATGTGCCCACTGCTGG - Intergenic
987707529 5:21474810-21474832 GACACTGCCCTGGACACTGCAGG + Intergenic
987738330 5:21873418-21873440 GACACTGATGTGCAGATGCCTGG + Intronic
993504495 5:88693487-88693509 GACTCTGATTTGGAGACTGCTGG - Intergenic
994521756 5:100846996-100847018 GACTCTGATATGCACACTTCCGG - Intronic
997201504 5:132012501-132012523 GCCACAGATGCCCACACTGCTGG + Intergenic
1001624886 5:173123496-173123518 TACACTAAAGTGCAAACTGCAGG - Intronic
1001649945 5:173309130-173309152 AACACTCATTTGCACACTGTAGG - Intergenic
1001938392 5:175723532-175723554 AACACAGATATGCAAACTGCAGG + Intergenic
1002188355 5:177466444-177466466 GACACTGTTCTGCACTCTGAGGG - Intronic
1002435607 5:179229085-179229107 GACACTGATCAGGACACTGAGGG - Intronic
1003396969 6:5761939-5761961 CTCACTGGTGTGCACACAGCAGG - Intronic
1006673779 6:35747303-35747325 GACACGGAACTGCACATTGCGGG + Exonic
1009020689 6:57945708-57945730 GACACTGCCCTGGACACTGCAGG - Intergenic
1012934473 6:105351807-105351829 AACACTGATGTGGCCAATGCTGG + Intronic
1014303495 6:119712488-119712510 GACACTGATGTATAACCTGCAGG + Intergenic
1019911856 7:4105634-4105656 GACAGTGATCTGCACTGTGCTGG + Intronic
1022876526 7:34538008-34538030 AACACTAATTTGCACACTACTGG + Intergenic
1028255220 7:88587206-88587228 ATCTCTGAAGTGCACACTGCAGG + Intergenic
1029626686 7:101724367-101724389 GACCCTGATGTGCTCACCTCAGG + Intergenic
1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG + Intronic
1031428806 7:121639910-121639932 GACAGTGCTGTGTACACAGCGGG - Intergenic
1034953088 7:155314179-155314201 GAACCTGCTTTGCACACTGCTGG - Intergenic
1035639691 8:1175205-1175227 GACATTTCTGTGCTCACTGCGGG - Intergenic
1040923565 8:52651611-52651633 GGCACTGATGATCAAACTGCTGG + Intronic
1041864024 8:62547957-62547979 GATACTGATGTGGATGCTGCTGG + Intronic
1047189087 8:122661711-122661733 GACACTTATTTTCATACTGCTGG + Intergenic
1048559765 8:135521360-135521382 GACAGTGAGGTCTACACTGCAGG + Intronic
1052102099 9:24460798-24460820 GTCAGTCATTTGCACACTGCAGG + Intergenic
1052773400 9:32709901-32709923 GACAGTGAGTTGCCCACTGCTGG + Intergenic
1056554406 9:87676837-87676859 GACAGGGATGTGCACATTGAAGG - Intronic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1058132186 9:101265670-101265692 GAAACTGATGCACATACTGCAGG - Intronic
1203367447 Un_KI270442v1:271143-271165 AAGACGGATGTGCGCACTGCTGG - Intergenic
1186171079 X:6877588-6877610 GACACTCATGGGCTGACTGCTGG - Intergenic
1186214373 X:7283190-7283212 GACAATAATGTGCTCACTTCTGG + Intronic
1190217323 X:48488609-48488631 GACTGTGATGTGGACACTCCTGG - Intergenic
1190311917 X:49122773-49122795 CACACTGATGTGGACACAGAGGG + Exonic
1193529706 X:82642088-82642110 GACACTTAAGTGAACATTGCTGG - Intergenic
1195904163 X:109827646-109827668 TACACTGATGTGCATTCTCCTGG - Intergenic
1196154672 X:112415493-112415515 GATGCTGCTGTGAACACTGCAGG + Intergenic
1196762469 X:119211862-119211884 GACACTGCTGTCAACACTGAGGG + Intergenic
1198579634 X:138049228-138049250 GACAATTATGTGCAGTCTGCTGG - Intergenic
1199311575 X:146327163-146327185 CACAATGATGTCCACAGTGCTGG - Intergenic
1199607486 X:149587446-149587468 GTCACTGACGTGCGCACTGGGGG - Exonic
1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG + Exonic
1199656211 X:149997820-149997842 GACACTGATGAGAACAGTGCTGG - Intergenic