ID: 1057425539

View in Genome Browser
Species Human (GRCh38)
Location 9:94946545-94946567
Sequence ATCTGAGAAGGGCCATTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057425539 Original CRISPR ATCTGAGAAGGGCCATTCTA AGG (reversed) Intronic
901514623 1:9736617-9736639 ATCTGTCAAGGGCCATTTTCTGG - Intronic
906107258 1:43302076-43302098 ATCTGTGGAGGGCCATTTTCAGG + Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
909299184 1:73989619-73989641 ATCACTGAAGAGCCATTCTATGG - Intergenic
910219424 1:84875550-84875572 ATCTGGCAAGGGCCATCCCATGG - Intronic
910666222 1:89728326-89728348 ATCTGTGAGGTGCCATTCTCAGG + Intronic
910742899 1:90540874-90540896 GGCTGAGAAGGGCCAGTCTAGGG + Intergenic
911874682 1:103145015-103145037 ACCTGAAAAGGGTCGTTCTAGGG - Intergenic
915015692 1:152731081-152731103 ATCTGACAAGGGTCATCCCATGG - Intergenic
923089412 1:230728189-230728211 ATCTGAAAAGGCCAATTTTAGGG + Intergenic
923353994 1:233135859-233135881 AACTGAAAAGGCCCATTCTATGG - Intronic
924570879 1:245236736-245236758 ATCTGAGAATGCCAATGCTAGGG + Intronic
1064513014 10:16115804-16115826 ATATGAGAAGGGACATATTAGGG + Intergenic
1065274527 10:24072635-24072657 AAATGATAAGGGCCATTCTTGGG + Intronic
1065328320 10:24569609-24569631 ATCTGAGCAGGGCCTTTATTGGG - Intergenic
1065644960 10:27824466-27824488 ATCTGTCAAGGGTCATTCCATGG - Intronic
1066788233 10:39029941-39029963 ATCTGAGAAGGGACATTTTGAGG - Intergenic
1068441056 10:57055503-57055525 ATGTGAGATGGGTCTTTCTAGGG - Intergenic
1072428333 10:95349288-95349310 TTCTGAGAAGGGCCTTTTTGAGG + Intronic
1074549125 10:114426947-114426969 ATCTGAGAAGGGCAAACCCAAGG - Intergenic
1076947476 10:133661025-133661047 GTCTGAGAAGGGTCGTTCCAGGG - Intergenic
1078210866 11:9268254-9268276 ATCTGAGAATGATCACTCTAGGG + Intergenic
1078521862 11:12070066-12070088 ATGAGAGAAGCCCCATTCTATGG + Intergenic
1078590756 11:12638775-12638797 ATCAGAGAAGGGTAATTCTGGGG - Intergenic
1079892095 11:26068606-26068628 ATCTGACAAGGGTCATCCCATGG - Intergenic
1081979634 11:47258203-47258225 ATCTGAGAAGGGGGTTTCTGGGG + Exonic
1082153698 11:48775340-48775362 ATCTGAAAAGGGATATTCCAGGG - Intergenic
1082743191 11:56933917-56933939 ATATGAGAAGGTCTATTCTGTGG - Intergenic
1083170036 11:60918371-60918393 ATCTGGCAAGGGTCATCCTATGG + Intronic
1083818151 11:65149390-65149412 ATCTGACAAAGGCCTTTCTAAGG + Intergenic
1086032628 11:82378624-82378646 ATCAGAGAAGCCCCATTCAATGG + Intergenic
1088906790 11:114161163-114161185 TTCTGAGATGGGCCAGTGTAAGG + Intronic
1089392385 11:118111089-118111111 ATGGTAGAAGGGCCATTCTAAGG - Intronic
1091471164 12:728948-728970 ATGTCAGAAGGGGCCTTCTAGGG - Intergenic
1091743769 12:2977866-2977888 TTCTGAGAAGGGCCCTTTTTTGG + Intronic
1091842646 12:3631795-3631817 ATGTTAGAAGGGCCAGTTTAGGG + Intronic
1094857445 12:34415801-34415823 ATCTGAGAAGGGATATTTTGGGG - Intergenic
1094866988 12:34546403-34546425 ATCTGTGAAGGGATATTTTAGGG - Intergenic
1095412637 12:41940787-41940809 ATATTTGAAAGGCCATTCTAAGG + Intergenic
1099921185 12:88959075-88959097 ATGTGGGAAGGGCCTTTCCATGG - Intergenic
1106463256 13:29990948-29990970 ATCAGAGAAGAGCCTTTCTCTGG - Intergenic
1106783048 13:33079028-33079050 ATTTGAGAAGCACCATTCCATGG + Intergenic
1109079249 13:57876980-57877002 ATGTTATTAGGGCCATTCTATGG - Intergenic
1110379613 13:74835349-74835371 ATCTGTAAAGGGCCATTGTATGG - Intergenic
1110946789 13:81431517-81431539 ATGGGAGAAGGGCCAGTCGATGG - Intergenic
1111389481 13:87573932-87573954 ATCTGAAAATGGTCATTCTTTGG - Intergenic
1118554116 14:66994511-66994533 TTCCGAGGAGGGCAATTCTATGG - Intronic
1121572499 14:94957531-94957553 ATCTGGAAAGGGCAATTCTGGGG + Intergenic
1126175795 15:45734114-45734136 ATCAGAGAAGGGCCGTTGTTTGG - Intergenic
1126354858 15:47784315-47784337 ATCTTAGAAGGGCCATCTTTAGG + Intergenic
1130990430 15:88872705-88872727 ATCTGATCAGGGCTGTTCTAGGG - Intronic
1136064752 16:27751134-27751156 GTCTGAGATGGGGCATTCTTTGG + Intronic
1136743003 16:32556292-32556314 ATCTGTGAAGGGACATTTTGGGG + Intergenic
1136744167 16:32568938-32568960 ATCTGTGAAGGGACATTCTGAGG + Intergenic
1140912045 16:79462997-79463019 CTCAGAGAAGGCCCACTCTAGGG + Intergenic
1203025432 16_KI270728v1_random:506294-506316 ATCTGTGAAGGGACATTCTGAGG - Intergenic
1203026596 16_KI270728v1_random:518937-518959 ATCTGTGAAGGGACATTTTGGGG - Intergenic
1203045125 16_KI270728v1_random:815494-815516 ATCTGTGAAGGGACATTTTGGGG + Intergenic
1203046289 16_KI270728v1_random:828137-828159 ATCTGTGAAGGGACATTCTGAGG + Intergenic
1145035225 17:19535930-19535952 CTGTGAGAAGGGGCTTTCTAAGG + Intronic
1145729477 17:27163309-27163331 ATCTGTGAAGGGACATTTCAGGG + Intergenic
1148635601 17:49146817-49146839 ATCTTAGAAGTACCAGTCTAAGG - Intronic
1149324224 17:55513311-55513333 ATCTGTGAAGAGCTATTCCAGGG + Intergenic
1149797350 17:59533016-59533038 ATTTGAGAGGGGCCTTCCTAGGG - Intergenic
1151520480 17:74625565-74625587 ATCTGACAAGCGTCATTCCATGG + Intergenic
1154936479 18:21063060-21063082 ATCTGGCAAGGGTCATTCAATGG + Intronic
1162357878 19:10197786-10197808 ATTTGACAGTGGCCATTCTAAGG - Intronic
1164379996 19:27726081-27726103 ATCTATGAAGGGACATTCTGAGG - Intergenic
1166876767 19:45902308-45902330 ATATGAGAAGGGCCCTTAGAGGG + Intronic
1167573859 19:50308353-50308375 ATCTAGGAAGGGCCCTTGTAGGG - Intronic
925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG + Intergenic
926019756 2:9484627-9484649 AGCTAAGCAGGGCCTTTCTAGGG - Intronic
927712048 2:25332145-25332167 ATTTGAGAAGGATCATTCTAGGG - Intronic
930876319 2:56221908-56221930 ATCTGGCAAGGGTCATTCCATGG + Intronic
931142770 2:59481819-59481841 ATCAGAGAAGGACCATTAAAAGG + Intergenic
931381045 2:61753704-61753726 ATCTGACAAGGGTCATCCCATGG + Intergenic
931642326 2:64392795-64392817 CTCTGAAGAGGGACATTCTAGGG - Intergenic
931767374 2:65468841-65468863 ATCTCAGAGGGGCAATTGTAAGG - Intergenic
931937813 2:67217585-67217607 TTCTGGGAAGGGTCATCCTAAGG - Intergenic
934747131 2:96766728-96766750 ATGTGCCAAGAGCCATTCTAGGG - Intronic
936226292 2:110656474-110656496 AACTGTGTAGGGACATTCTACGG - Intronic
936796744 2:116215209-116215231 TTCTGAGAAAGGCCATGTTAAGG - Intergenic
940270630 2:151886181-151886203 ATGTGTGATGGACCATTCTAAGG + Intronic
940597629 2:155815422-155815444 ATCAGAGGATAGCCATTCTAGGG + Intergenic
940624737 2:156159603-156159625 ATCTGGGAAGGGCAATTTCAGGG + Intergenic
941605537 2:167592081-167592103 ATCTGAGATGGGGAAATCTATGG + Intergenic
942042672 2:172081298-172081320 ATGCGAGAAGGGCCAGTCTGGGG - Exonic
946162172 2:217841898-217841920 ATCTGAGAAGGTTCATCTTAAGG - Intronic
947233902 2:227920237-227920259 ATCTGGTAAGGGCATTTCTATGG + Intronic
1169665588 20:8032258-8032280 ATCTCTGAAGGGCCATTAGAAGG - Intergenic
1169667316 20:8052064-8052086 CTCTTAGAAGGGCAACTCTATGG - Intergenic
1171296447 20:24021201-24021223 ATCTGAGAAGAGCAATTACAGGG - Intergenic
1173362280 20:42355404-42355426 ATCTGAGAATGACCAAACTAAGG + Intronic
1174224998 20:48990979-48991001 ATGTGAGAATGGCCACACTAAGG + Intronic
1174406430 20:50306137-50306159 ATTTGAGAAGATCCATGCTAGGG + Intergenic
1176657295 21:9598610-9598632 GTTTGAGAAGAGACATTCTATGG + Intergenic
1179052638 21:37901391-37901413 ATCTGAAAAGTGCCAGTGTATGG + Intronic
1180066506 21:45415192-45415214 ACCTGCGAAGGGCCACTCTGTGG + Intronic
1183169427 22:36175371-36175393 ATCAGAGAAGGCACATTCCATGG + Intergenic
1184432727 22:44450787-44450809 ATCTGGGAAGGCCCCTTATAAGG + Intergenic
950653016 3:14419387-14419409 ATCTGAGAAGGGGCATGATGCGG + Intronic
952087398 3:29842044-29842066 GTCTAAGAACAGCCATTCTAAGG - Intronic
952485863 3:33808967-33808989 ATCTGAGAATTTCCAATCTAGGG - Intronic
955148206 3:56341228-56341250 ATCTTACAAAGGCTATTCTAAGG + Intronic
955783324 3:62509384-62509406 ATCTCAGAATGGCCATCCTGTGG + Intronic
956940322 3:74153161-74153183 ATCTGAGAAGGGCCACTTCTTGG + Intergenic
957300119 3:78381209-78381231 ATCTGAAAAGGGTCATTTCATGG + Intergenic
959483121 3:106897466-106897488 ATCCGAGAAGGCCCATTCCAAGG - Intergenic
960371214 3:116842687-116842709 ATCTGAGAATGCTGATTCTAGGG + Intronic
962778186 3:138684000-138684022 AGGTGAGAAGGGCCAATCTTAGG - Intronic
964812906 3:160684808-160684830 ATAGGAGAAGGGTGATTCTAAGG - Intergenic
964812925 3:160684991-160685013 ATAGGAGAAGGGCGATTCTAAGG - Intergenic
964870392 3:161307518-161307540 ATAGGAGAAGGGCCAGTCAATGG - Intergenic
965545446 3:169910754-169910776 ATCTCAGAAGAGCCCTTCTTGGG - Intergenic
966135290 3:176691200-176691222 ATCTGTGAAAGCCCATTCTTAGG - Intergenic
966194579 3:177300281-177300303 ATCTGAGGAGGGCATTTATAGGG - Intergenic
970309192 4:14764235-14764257 ATCTGAGAAGAGTCCTTCAAGGG + Intergenic
970721448 4:18994041-18994063 ATCTGTCAAAGGTCATTCTATGG - Intergenic
971515341 4:27479191-27479213 ATCTGATGAGGCCCATTTTATGG - Intergenic
972151605 4:36098206-36098228 ATCTGAGAAATGCCATTCCTGGG - Intronic
977692585 4:99931694-99931716 ATTTGAAAAGGACCACTCTATGG - Intronic
977708268 4:100095464-100095486 ATCTGAAAAGGAACATTCAAAGG + Intergenic
978803388 4:112776031-112776053 TTCTGAGAAGCGCCAGCCTAGGG + Intergenic
980557704 4:134430853-134430875 CTCTGAAGAGGGCCATTCCAGGG + Intergenic
983842721 4:172477346-172477368 ATGTAAGAAGGAACATTCTAGGG + Intronic
984260333 4:177436937-177436959 ATCTGGCAAGGGCCATCCCAAGG - Intronic
985450932 4:190061825-190061847 GTCTGAGAAGGGTCGTTCCAGGG - Intergenic
985694413 5:1331768-1331790 ATCTGAGCAGGGCCACGCTCGGG + Intronic
985855216 5:2419012-2419034 ATCTGGGAGGGGCTATTCTGAGG + Intergenic
988179833 5:27775812-27775834 ATCTGAGAAAAACCATTCTCAGG + Intergenic
988527543 5:32000069-32000091 GCCTGAGAAGGGCCATTTTCTGG - Intronic
989848434 5:46176276-46176298 ATCTGTGAAGGGATATTTTAAGG - Intergenic
996522190 5:124439417-124439439 ATCTGAGAAGGGTCATTCATGGG + Intergenic
999374467 5:151077115-151077137 ATCTGACAAGGGTCATGCCAAGG + Intronic
1004118022 6:12790274-12790296 AAGTGAGCAGGGCAATTCTAGGG - Intronic
1004644975 6:17552150-17552172 TTCTCAGAAGGGCCATTGGATGG - Intronic
1006030748 6:31175129-31175151 ATCTGAGCAGCGCCATGCAAGGG + Intronic
1006727473 6:36210400-36210422 ACCTGGGAGGGGCCATCCTACGG + Exonic
1009585967 6:65602777-65602799 ATGTGTGAAGGCCCATTGTAGGG + Intronic
1015969450 6:138729793-138729815 ATCTGAGATGTGCCATTCTCAGG + Intergenic
1020558004 7:9693565-9693587 ACCAGAGGATGGCCATTCTAGGG - Intergenic
1020926087 7:14326500-14326522 AGGTGAGAATGTCCATTCTATGG - Intronic
1023350925 7:39319547-39319569 ATCTCAGGTGGGCCATGCTAGGG + Intronic
1023712094 7:43005916-43005938 TTCTGAGAAGAGCCTTTATAAGG - Intergenic
1023734626 7:43223932-43223954 ATCTCAGAAGGGGCAATCAAAGG - Intronic
1024455223 7:49598247-49598269 ATTTTAAAAGGGCCATTCTCTGG + Intergenic
1025534183 7:61927773-61927795 ATCTGTGAAGGGACATTTGAGGG + Intergenic
1026131950 7:67628229-67628251 ATCTGAGAAGGCACATTCCAAGG + Intergenic
1029450619 7:100640318-100640340 TTCTGAGAAGCCGCATTCTAGGG - Intronic
1030599708 7:111579869-111579891 ATCTGAGTAGGGCATGTCTATGG - Intergenic
1030630627 7:111892124-111892146 AGGTGAGAAGGGCCTTTCTAAGG - Intronic
1032906598 7:136374646-136374668 ATCTGTGAAGGTCCTTTATAAGG + Intergenic
1033058162 7:138079161-138079183 ATCAGAAAAGGGGAATTCTATGG - Intronic
1036966414 8:13303265-13303287 ATCTGAGATGGGGCATCCTGGGG + Intronic
1040130324 8:43788288-43788310 ATCTGTAAAGGGCCATTTAAGGG + Intergenic
1040281357 8:46049261-46049283 ATCTGTAAAGGGACATTTTAGGG + Intergenic
1040321844 8:46314639-46314661 AACTGAGAAGGGACATTTTGGGG - Intergenic
1040327139 8:46354102-46354124 ATCTGTGAAGGGGCATTTCATGG - Intergenic
1040332759 8:46399864-46399886 ATCTGAGAAAGGGCATTTCAGGG - Intergenic
1047466648 8:125122553-125122575 AACAGAGAAAGGGCATTCTAGGG - Intronic
1047727477 8:127696447-127696469 ATCTGAGATGAGCCATTTTCTGG - Intergenic
1048384279 8:133897266-133897288 AAATGAGAAGGGTCATTCAAAGG - Intergenic
1051274704 9:15387617-15387639 CTCTTAGAGGAGCCATTCTAAGG - Intergenic
1051872618 9:21756138-21756160 ATATGAGAAGGGGCTTTCTATGG + Intergenic
1057425539 9:94946545-94946567 ATCTGAGAAGGGCCATTCTAAGG - Intronic
1057719953 9:97524100-97524122 ATCTGAGACGGGTCTTTCTAAGG + Intronic
1058875110 9:109237525-109237547 ATTTGAGACGGTCCACTCTATGG - Intronic
1058993925 9:110281024-110281046 ATCAGACAAGGGTCATTCTTGGG + Intergenic
1203635017 Un_KI270750v1:102184-102206 GTTTGAGAAGAGACATTCTATGG + Intergenic
1186550555 X:10500801-10500823 CTCTGAGGAGGGCCAATCTAAGG + Intronic
1186823307 X:13313345-13313367 GTCTGAGAATGGCCATTCAGAGG + Intergenic
1187437303 X:19284388-19284410 ATCTGATACAGGCCATGCTAAGG - Intergenic
1188353796 X:29164464-29164486 ACCTGTCAATGGCCATTCTAAGG - Intronic
1191259941 X:58306672-58306694 ATCTGCGAAGGGACATTTCAGGG + Intergenic
1191261665 X:58328995-58329017 ATCTGAGAAAGGGCATTTGAAGG + Intergenic
1192536502 X:71932969-71932991 ATTTGGGATGGGCCTTTCTAGGG - Intergenic
1194605471 X:95973625-95973647 ATCTGAGAGTGGACATTCTGGGG + Intergenic
1195990334 X:110676230-110676252 ATCTGAAAAGGGCCACTGTTAGG - Exonic
1198739907 X:139831098-139831120 ATCTGAAAAGTGCAATTTTAAGG - Intronic
1200282964 X:154794305-154794327 AACTGAGAAGGAGCATTTTAAGG - Intronic