ID: 1057426031

View in Genome Browser
Species Human (GRCh38)
Location 9:94950509-94950531
Sequence CTGTGCATCTGGGGCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057426020_1057426031 12 Left 1057426020 9:94950474-94950496 CCCAGTGGTCATGCTCCTTCCCC 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426024_1057426031 -7 Left 1057426024 9:94950493-94950515 CCCCTGCAGGTCTCACCTGTGCA 0: 1
1: 0
2: 0
3: 40
4: 316
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426017_1057426031 23 Left 1057426017 9:94950463-94950485 CCAAGCCCTCACCCAGTGGTCAT 0: 1
1: 0
2: 2
3: 21
4: 222
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426023_1057426031 -3 Left 1057426023 9:94950489-94950511 CCTTCCCCTGCAGGTCTCACCTG 0: 1
1: 0
2: 10
3: 60
4: 454
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426025_1057426031 -8 Left 1057426025 9:94950494-94950516 CCCTGCAGGTCTCACCTGTGCAT 0: 1
1: 0
2: 2
3: 20
4: 221
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426018_1057426031 18 Left 1057426018 9:94950468-94950490 CCCTCACCCAGTGGTCATGCTCC 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426019_1057426031 17 Left 1057426019 9:94950469-94950491 CCTCACCCAGTGGTCATGCTCCT 0: 1
1: 0
2: 2
3: 17
4: 171
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426021_1057426031 11 Left 1057426021 9:94950475-94950497 CCAGTGGTCATGCTCCTTCCCCT 0: 1
1: 0
2: 3
3: 49
4: 316
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data
1057426026_1057426031 -9 Left 1057426026 9:94950495-94950517 CCTGCAGGTCTCACCTGTGCATC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057426031 Original CRISPR CTGTGCATCTGGGGCTCAGA TGG Intronic
No off target data available for this crispr