ID: 1057432372

View in Genome Browser
Species Human (GRCh38)
Location 9:95005415-95005437
Sequence GCGGGTGGCCTCCCGAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057432365_1057432372 0 Left 1057432365 9:95005392-95005414 CCCGGCGAGTTCCGCGGGCGGGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 136
1057432358_1057432372 16 Left 1057432358 9:95005376-95005398 CCCCTGCGGTGAGGCGCCCGGCG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 136
1057432360_1057432372 14 Left 1057432360 9:95005378-95005400 CCTGCGGTGAGGCGCCCGGCGAG 0: 1
1: 0
2: 0
3: 10
4: 75
Right 1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 136
1057432359_1057432372 15 Left 1057432359 9:95005377-95005399 CCCTGCGGTGAGGCGCCCGGCGA 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 136
1057432366_1057432372 -1 Left 1057432366 9:95005393-95005415 CCGGCGAGTTCCGCGGGCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057432372 Original CRISPR GCGGGTGGCCTCCCGAGGTG CGG Intronic
900284453 1:1892259-1892281 GCGGGTGGTGTCCCAGGGTGTGG - Intergenic
900433091 1:2612063-2612085 GGCGCTGGCCTCCCAAGGTGGGG - Intronic
900484755 1:2916999-2917021 GAGGCTGGCCTGCCGAGGTCAGG - Intergenic
900513394 1:3070520-3070542 GCGGGCGGCCTGCAGAGGAGGGG - Intronic
900547634 1:3237365-3237387 GGGGGTGGGGTCCCGAAGTGGGG - Intronic
901432208 1:9223228-9223250 CCGCGTGGACTCCCTAGGTGTGG + Intergenic
901451694 1:9339970-9339992 GTGGGGGTCCTCCCGAGGTGGGG - Intronic
901834091 1:11912439-11912461 GCGGGTGTTCTCCCCATGTGCGG + Intergenic
902400641 1:16155124-16155146 GGGTGCGGCCTCCCAAGGTGTGG - Intronic
902896840 1:19485330-19485352 ACGGGTGGCTTCCCGGGGTGGGG - Intronic
904291529 1:29488956-29488978 GAGGGTGGTTTCCCCAGGTGTGG - Intergenic
904315291 1:29656176-29656198 GCATGTTGCCTCCTGAGGTGGGG - Intergenic
904620426 1:31771930-31771952 GCGGGCGGCTTCCGGCGGTGGGG - Intergenic
914713829 1:150237914-150237936 GCGGGTGGTCACCTGAGGTCAGG + Intergenic
917794599 1:178523850-178523872 GCAGGTGGCCTCCAGAAGTGGGG - Intronic
924774700 1:247107873-247107895 GCGGCTGGCTTCCCAAAGTGGGG - Intergenic
1066446892 10:35491840-35491862 GCGGGTGGGATCACGAGGTCAGG - Intronic
1067122228 10:43483465-43483487 GCGGGTGGACACCTGAGGTCGGG - Intergenic
1072819066 10:98538259-98538281 GCGGGTGTTCTCCCCATGTGCGG - Intronic
1076385474 10:130052143-130052165 GGTGGTGGCCTCCTGAGGTGGGG - Intergenic
1076736954 10:132463219-132463241 GCCGGTGGCCACCCGAGGCTGGG + Intergenic
1077366569 11:2163656-2163678 TGGGGTGCCCTCCCAAGGTGGGG - Intergenic
1083846323 11:65336039-65336061 GCGGGTGAACTCCTGAGGTCAGG - Intronic
1100329976 12:93572851-93572873 ACAGGTGGCCGCCCGAGCTGGGG - Exonic
1102180358 12:110907800-110907822 GCCCCTGGCCACCCGAGGTGTGG + Intergenic
1102590530 12:113953258-113953280 GCGGGTGATCACCCGAGGTCAGG + Intronic
1104910684 12:132238757-132238779 GCGGGTGGCCTGCAGATGAGGGG - Intronic
1112554724 13:100456394-100456416 GCGGGTGTTCTCCCGGTGTGCGG + Intronic
1117367787 14:55048146-55048168 GCGGGTGGTCACCTGAGGTCAGG - Exonic
1119238953 14:73042940-73042962 GCGGGTGGTCACCTGAGGTCAGG + Intergenic
1119484386 14:74978401-74978423 GCGCCTGGCCTGGCGAGGTGCGG - Intergenic
1122661190 14:103296679-103296701 GCGGGAGAACTCCCGAGGTCAGG - Intergenic
1129300765 15:74624221-74624243 GCAGATGGCCTCCTGGGGTGAGG + Intronic
1129488859 15:75904092-75904114 GCGGGTGGCCTGGTGAGGAGAGG + Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130259537 15:82344557-82344579 GAGGGCAGCCTCCCCAGGTGGGG + Intronic
1130269141 15:82434611-82434633 GAGGGCAGCCTCCCCAGGTGGGG - Intronic
1130281728 15:82524629-82524651 GAGGGCAGCCTCCCCAGGTGGGG - Intergenic
1130473097 15:84240791-84240813 GAGGGCAGCCTCCCCAGGTGGGG - Intronic
1130480511 15:84354856-84354878 GAGGGCAGCCTCCCCAGGTGGGG - Intergenic
1130484712 15:84392295-84392317 GAGGGCAGCCTCCCCAGGTGGGG - Intergenic
1130491201 15:84432903-84432925 GAGGGCAGCCTCCCCAGGTGGGG + Intergenic
1130502784 15:84511703-84511725 GAGGGCAGCCTCCCCAGGTGGGG + Intergenic
1130595382 15:85245381-85245403 GAGGGCAGCCTCCCCAGGTGGGG - Intergenic
1130867100 15:87942463-87942485 GCAGGTGGCCTCCCGAGAGAGGG - Intronic
1132639478 16:971090-971112 GAGCGGGGCCTCCCGGGGTGTGG - Intronic
1133340107 16:5030521-5030543 GCAGGAGGCCTCCCAAGGGGCGG - Intronic
1133443501 16:5840349-5840371 GGGGGTGGCCTCTCTGGGTGTGG - Intergenic
1133644501 16:7751387-7751409 GCGGGTGGTCACCTGAGGTCAGG + Intergenic
1140852162 16:78945133-78945155 CAGGGTGGACTCCAGAGGTGCGG - Intronic
1140891066 16:79285624-79285646 TCTGGTGGCCTCCAGGGGTGGGG + Intergenic
1142996009 17:3760938-3760960 GCTGGTGGCCTCCAAGGGTGAGG - Intronic
1143764807 17:9130508-9130530 GCAGCTGGCCACCCCAGGTGGGG - Intronic
1144742970 17:17594504-17594526 GCGGGCGACCTCAAGAGGTGGGG - Intergenic
1147164695 17:38586988-38587010 GCGGGTGGGCACCCGGGGAGGGG + Intronic
1148054193 17:44783957-44783979 GCGGGTGGGATCACGAGGTCAGG + Intergenic
1148617672 17:49013398-49013420 GCGGGAGGCCTCCCACTGTGAGG - Intronic
1150109754 17:62488160-62488182 GCGGGTGAACTCCAGAGGTCAGG - Intronic
1157825043 18:50805017-50805039 GCGGGTGGGATCACGAGGTCAGG - Intronic
1159025350 18:63178214-63178236 GTGGGTGATCTCCCGAGGTTGGG - Intronic
1160824073 19:1071342-1071364 CCGGGCGGGCCCCCGAGGTGAGG + Intronic
1160956777 19:1697239-1697261 GAGGGTGGAGTCCAGAGGTGAGG + Intergenic
1162292442 19:9790347-9790369 GCGGGTGTTCTCCCCATGTGTGG + Intronic
1163282582 19:16326281-16326303 GAGGGGGGCCTCCGGAGGTTGGG + Intronic
1163579691 19:18130931-18130953 GAGGGTGGCCATCCTAGGTGGGG + Intronic
1165780830 19:38433533-38433555 GCCGTTGGCCGCCGGAGGTGGGG - Intergenic
1166514700 19:43437711-43437733 GCGGGTGTTCTCCCCATGTGCGG - Intergenic
1166786042 19:45367739-45367761 GCGGGTGGACACCTGAGGTCGGG - Intronic
1166842457 19:45706460-45706482 GCGGGTGGACACCTGAGGTCAGG - Intergenic
1168576673 19:57517335-57517357 GGGGGTGGCCTCCCAAGGCTCGG - Intronic
925931335 2:8710346-8710368 GCTGCTGGCCTCCCATGGTGGGG - Intergenic
926055099 2:9769728-9769750 GCGGGGGGGCTCTTGAGGTGGGG + Intergenic
926056925 2:9779184-9779206 GCTGCTGGCCTCCCGAGGCCCGG + Intergenic
926548418 2:14270986-14271008 GCGGGTGGTCACCTGAGGTCAGG + Intergenic
926626938 2:15099073-15099095 GCGGCAGGCCTCCCGAAGTCAGG + Intergenic
927702448 2:25276905-25276927 GGGAGTGGCCTCCCGGGCTGAGG - Intronic
929583643 2:43100664-43100686 GTGGGGGGCGTCCCGGGGTGGGG - Intergenic
932752159 2:74378176-74378198 GCGGGTGGGCTCCCGTGTAGAGG - Exonic
936103570 2:109604496-109604518 GCGGGTGGGATCACGAGGTCAGG + Intronic
939801944 2:146721198-146721220 GTGGGTGGCCACCCCATGTGAGG + Intergenic
940968796 2:159871375-159871397 GCTGGTGGCCTCCTGAAATGGGG - Intronic
943266446 2:185738713-185738735 GGCGGTGGCCTCCTGAGGGGCGG - Exonic
945225893 2:207530523-207530545 GCGGGCGGCCTCCCCCGGGGCGG - Intronic
948205357 2:236160302-236160324 GATGGTGGGCTGCCGAGGTGGGG + Intergenic
948870785 2:240796888-240796910 GAGGGGGGCGTCCCGAGGGGAGG - Intronic
949004880 2:241639675-241639697 TCGGGTGGTCTCCCTTGGTGTGG + Intronic
1171303948 20:24088954-24088976 CAGGCTGGCCTCCCGGGGTGGGG + Intergenic
1171984040 20:31646986-31647008 GGGGGTGCCCTCCCCAAGTGAGG + Intergenic
1175861488 20:62152421-62152443 GCCTGAGGCCTCCCGAGGTGAGG - Intronic
1179708048 21:43193877-43193899 GTGGGTGCCCTCCTAAGGTGAGG - Intergenic
1182871929 22:33655226-33655248 GCAGGTGTCCTCCCCTGGTGTGG + Intronic
1184133498 22:42532066-42532088 GCGGGTGTTCTCCCCATGTGCGG - Intergenic
1185064037 22:48621762-48621784 GTGACTGGCCTCTCGAGGTGGGG + Intronic
1185270161 22:49926109-49926131 GCAGGTGGCATCCCCAGGCGAGG - Intronic
1185408447 22:50670956-50670978 GAGGGTCCTCTCCCGAGGTGTGG + Intergenic
950765126 3:15267767-15267789 GTGGGTGGCCTCCCAAGGAGTGG - Intronic
951887757 3:27540576-27540598 CCGGGTGGCCACCTGAGGTTAGG + Intergenic
954990526 3:54837092-54837114 GGGGGTGGCCTCCAGAACTGTGG + Intronic
960874971 3:122287023-122287045 GCCGGTGCCCTTCCTAGGTGGGG - Intergenic
964404773 3:156338061-156338083 GCTGCTGGCCTCCAGAGATGAGG + Intronic
966883314 3:184361744-184361766 GCGCGGGGCCTCCCGAGAGGCGG + Intronic
967336125 3:188346490-188346512 GCGGGTGGACTCCTGAGGTCAGG - Intronic
967928527 3:194672619-194672641 TCTGCTGGCGTCCCGAGGTGTGG + Intergenic
968482277 4:839398-839420 GTGGGTGGTCACCCGAGGTCAGG - Intergenic
969536596 4:7760165-7760187 GGGGGTGGCCTCCAGAGCTGAGG + Exonic
970885524 4:20984068-20984090 GCCGGCGGCCCCCCGGGGTGAGG + Intronic
971025388 4:22584331-22584353 GCGGGTGGACACCTGAGGTCAGG - Intergenic
976593916 4:86876300-86876322 GTGGGAGGCTTCCTGAGGTGGGG + Intronic
996714725 5:126578054-126578076 GCAGGTGGACTCCCGACTTGAGG + Intronic
997163565 5:131634956-131634978 CCGAGCGGACTCCCGAGGTGAGG - Exonic
1002079374 5:176728343-176728365 GAGGCTGGCCTGCCGAGGAGTGG - Intergenic
1003164442 6:3663894-3663916 ACAGGTGGACTCCTGAGGTGGGG + Intergenic
1003427789 6:6008917-6008939 GCGGGAGGCTTTCCGAGGGGCGG + Intergenic
1006896640 6:37475469-37475491 GACAGCGGCCTCCCGAGGTGTGG + Intronic
1007094872 6:39206995-39207017 GCATGTGGCCTCCAGAGCTGGGG + Intronic
1011685379 6:89819618-89819640 GCAGGTGGCCGCTCGGGGTGAGG - Exonic
1013580121 6:111525730-111525752 GCGGGTGGGATCACGAGGTCAGG + Intergenic
1015229356 6:130896488-130896510 GCGGGTTGCCTCCCCACTTGTGG - Intronic
1017373440 6:153739066-153739088 GCGGGTGATCTCCTGAGGTCAGG + Intergenic
1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG + Intronic
1019394444 7:809696-809718 GCGGGTGGTCACCTGAGGTCAGG + Intergenic
1019409211 7:899323-899345 GCGGGTGGCCTCCCGAGTCCTGG - Intronic
1023026820 7:36058329-36058351 GCTGGTGGCCTCCCACAGTGAGG - Intergenic
1023788669 7:43734617-43734639 GCGGGTGTTCTCCCCATGTGCGG + Intergenic
1024499796 7:50093062-50093084 GCGGGTGCCCTCATCAGGTGAGG - Exonic
1038297969 8:26313756-26313778 GCAGGTGGCCTCCAGAAGCGAGG + Intronic
1041906094 8:63035531-63035553 GCGGGTGGACTACTGAGGTCAGG - Intronic
1042921472 8:73924130-73924152 GCGGGTGGACACCTGAGGTCAGG - Intergenic
1049239292 8:141528814-141528836 GCGGGTGGCCTGCTGGGGTTCGG - Intergenic
1049691291 8:143960935-143960957 GCGGGAGGCCTCCAGCTGTGGGG - Intronic
1051174178 9:14347044-14347066 GCGGGTTGTCTCCCGAGTGGGGG - Intronic
1054706863 9:68471689-68471711 GCGGGTGAACTCCTGAGGTCAGG + Intronic
1056752929 9:89364818-89364840 GAGGCTGGCCTCCCCAGGCGAGG - Intronic
1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG + Intronic
1060934591 9:127507844-127507866 GTGGGTGCCGTCCCGGGGTGGGG - Intronic
1060987019 9:127825641-127825663 GGGGGTGGTCTCTCGGGGTGGGG + Intronic
1062063697 9:134514548-134514570 TCTGGTGGTCTCCTGAGGTGGGG + Intergenic
1062348499 9:136127070-136127092 GCCGAAGGCCTTCCGAGGTGGGG + Intergenic
1189262479 X:39688675-39688697 GCGGCTGGCCCCCAGGGGTGGGG + Intergenic
1190745913 X:53321486-53321508 GCGGGTGGCAGCCGCAGGTGGGG - Intergenic
1192315085 X:70044793-70044815 GCGGTGGGCCACCAGAGGTGGGG + Intronic
1198310058 X:135421901-135421923 GGGGGTGGCCCCCCGCAGTGAGG + Intergenic
1202367042 Y:24172678-24172700 GAGGGCAGCCTCCCCAGGTGGGG - Intergenic
1202373395 Y:24213024-24213046 GAGGGCAGCCTCCCCAGGTGGGG + Intergenic
1202497386 Y:25457096-25457118 GAGGGCAGCCTCCCCAGGTGGGG - Intergenic
1202503739 Y:25497445-25497467 GAGGGCAGCCTCCCCAGGTGGGG + Intergenic