ID: 1057442037

View in Genome Browser
Species Human (GRCh38)
Location 9:95090155-95090177
Sequence GTGACGTTGCTAGTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057442037_1057442041 0 Left 1057442037 9:95090155-95090177 CCTGCAGCCACTAGCAACGTCAC No data
Right 1057442041 9:95090178-95090200 AGGGCCATCTGTCCCCTGAGTGG No data
1057442037_1057442043 4 Left 1057442037 9:95090155-95090177 CCTGCAGCCACTAGCAACGTCAC No data
Right 1057442043 9:95090182-95090204 CCATCTGTCCCCTGAGTGGTAGG No data
1057442037_1057442047 21 Left 1057442037 9:95090155-95090177 CCTGCAGCCACTAGCAACGTCAC No data
Right 1057442047 9:95090199-95090221 GGTAGGTACGAACAGTTAACTGG No data
1057442037_1057442048 22 Left 1057442037 9:95090155-95090177 CCTGCAGCCACTAGCAACGTCAC No data
Right 1057442048 9:95090200-95090222 GTAGGTACGAACAGTTAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057442037 Original CRISPR GTGACGTTGCTAGTGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr