ID: 1057445003

View in Genome Browser
Species Human (GRCh38)
Location 9:95107622-95107644
Sequence GTGGGGCTTTAATTGATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057445003_1057445011 21 Left 1057445003 9:95107622-95107644 CCACAAATCAATTAAAGCCCCAC 0: 1
1: 0
2: 4
3: 12
4: 152
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057445003 Original CRISPR GTGGGGCTTTAATTGATTTG TGG (reversed) Intronic
901225775 1:7612213-7612235 GTGGGGATTTGATTGAGTGGTGG + Intronic
903316540 1:22512322-22512344 GTGCTGCTTTAATAGATTTGGGG - Intronic
903399962 1:23035563-23035585 GTGTGGTTTTAATAAATTTGGGG + Intronic
905608421 1:39326006-39326028 CTGGTGGTTTGATTGATTTGGGG + Intronic
907670300 1:56468699-56468721 CTGGGGCTTGACATGATTTGAGG - Intergenic
908730994 1:67226343-67226365 GTGGGGGTTTTATTGAGTGGTGG + Intronic
908896788 1:68910007-68910029 GAGGGGCTTTTATTGAGTGGTGG - Intergenic
909718868 1:78742313-78742335 TTGTGACTTTAATTGATTGGTGG + Intergenic
911404279 1:97416888-97416910 GTGTGGCTATATTTTATTTGAGG - Intronic
912339124 1:108893456-108893478 GTGGACATTTAATTCATTTGTGG + Intronic
923315233 1:232773587-232773609 GTGGGGGTTTTATTGATTGGTGG - Intergenic
923975469 1:239257275-239257297 GTGGGGATTTTATTGAGTGGTGG + Intergenic
924269819 1:242320811-242320833 GTTGGGATTTAATTGATTTGGGG + Intronic
1063480957 10:6376029-6376051 GTTGGGCTTTAAGAGATCTGAGG - Intergenic
1065285321 10:24181975-24181997 GTGGGGCTTTGAGAGAATTGTGG + Intronic
1066715090 10:38277967-38277989 GTTGGGATTTAATTGATTTGGGG - Intergenic
1066782994 10:38972744-38972766 GTTGGGATTTAATTGATTTGAGG + Intergenic
1068980798 10:63060477-63060499 TTGGGGCTTTAACTTGTTTGGGG + Intergenic
1070750132 10:78959217-78959239 GTTCTGATTTAATTGATTTGGGG - Intergenic
1072137062 10:92557043-92557065 GTGGGATTTTAATCTATTTGGGG - Intronic
1075604465 10:123794297-123794319 GTGGGGCTTTGATGTCTTTGGGG - Intronic
1079190480 11:18272863-18272885 ATGGGGCTTTAATAGGTTTAGGG + Intergenic
1080524239 11:33098105-33098127 GTGTAGCTATAATTGACTTGAGG + Intronic
1081040033 11:38198832-38198854 GTGGGGAGTTATTTGATTTTAGG + Intergenic
1087933719 11:104006839-104006861 GTGGGGGTTTTATTGAATGGTGG - Intronic
1090461668 11:126896657-126896679 CTGGGACTTTAATTCTTTTGAGG + Intronic
1091555201 12:1567766-1567788 GATGGGCTTTGATGGATTTGTGG + Intronic
1092455868 12:8642133-8642155 GTTGAGTTTTAATTGATGTGGGG - Intronic
1092595907 12:10004360-10004382 GTGGGGGTTTTACTGAGTTGTGG + Intronic
1093594930 12:20948649-20948671 GAGGGGCTTTAAGTGTGTTGAGG + Intergenic
1094415582 12:30211788-30211810 GTGGAGCTTTAATGCCTTTGTGG - Intergenic
1094716433 12:33019038-33019060 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
1096511401 12:52131659-52131681 GTGTGGCTTTAGTGGATCTGAGG + Intergenic
1097087230 12:56477545-56477567 GTGGGGCTCTGATTCCTTTGAGG - Exonic
1099305172 12:80945166-80945188 TTGGGGATTTCTTTGATTTGAGG - Intronic
1100691870 12:97046948-97046970 TTGGGGCTCTATTTAATTTGTGG + Intergenic
1100779589 12:98009609-98009631 TTGGGGCTATAAATGATTTTTGG + Intergenic
1101276964 12:103213447-103213469 GAAGGGCTTGAATTAATTTGGGG + Intergenic
1101630162 12:106485320-106485342 GTTGAGATTTAATTGATATGGGG - Intronic
1101977398 12:109372001-109372023 GTTGGACTTTTATTGATTTATGG + Intronic
1104871802 12:132004374-132004396 TTGGGGATTTAATTAATGTGTGG + Intronic
1107662971 13:42658489-42658511 GTGGTGGTTTATTGGATTTGGGG - Intergenic
1108710662 13:53029178-53029200 CTGAGGCTTTAATTCATTTCCGG - Intronic
1110525342 13:76530333-76530355 GTGGGGCATTTTTTGATTTGTGG + Intergenic
1113187337 13:107703657-107703679 ATAGGGCTTTTACTGATTTGAGG - Intronic
1115171919 14:30518090-30518112 GTGGGGGTTTTAGTGATTTGGGG + Intergenic
1117380989 14:55162697-55162719 GAGGGGCTGTGATTGAATTGGGG - Intronic
1117989977 14:61423735-61423757 GTGGGGCTATAATACAGTTGGGG + Intronic
1120280452 14:82431703-82431725 GTGGGGGTTTTATTGAGTAGTGG + Intergenic
1138700329 16:58855994-58856016 CCAGGGCTTTAATTTATTTGTGG + Intergenic
1140246571 16:73255346-73255368 TGTGGGCTTTATTTGATTTGGGG - Intergenic
1147391113 17:40109864-40109886 TTGTGGCTTAAATTGTTTTGAGG + Intergenic
1149989860 17:61376996-61377018 CTGGGGCTTTAATCTCTTTGAGG - Intronic
1150927131 17:69544505-69544527 GTGGGGCATTAACTATTTTGAGG - Intergenic
1152768133 17:82151965-82151987 GTGGGCCTTTATTCTATTTGTGG - Intronic
1153369182 18:4294788-4294810 GTGGGGGTTTTATTGAGTGGTGG + Intronic
1158406048 18:57160380-57160402 ACGGGGTTTGAATTGATTTGAGG - Intergenic
1159089455 18:63831367-63831389 GTGGGCATTTACTTTATTTGGGG - Intergenic
1159105759 18:64000793-64000815 GTCAGGCTTTTATTCATTTGTGG - Intronic
1202645257 1_KI270706v1_random:133278-133300 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
926391494 2:12398417-12398439 GTGTTGCTTTAATGTATTTGAGG + Intergenic
927082032 2:19640062-19640084 GTATGTCTTTAATTGTTTTGAGG - Intergenic
927346339 2:22047034-22047056 GTGGGGTTTTAATTGCATTTGGG - Intergenic
927401029 2:22710351-22710373 TTAAGTCTTTAATTGATTTGGGG + Intergenic
927741014 2:25569637-25569659 GTGGGGGTATATTTGATTCGGGG + Intronic
932261461 2:70331044-70331066 GAGGGGCTTTAACTGAGATGGGG + Intergenic
934507664 2:94906864-94906886 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
935894483 2:107719864-107719886 GTGGGGATTTTATTGAGTGGTGG - Intergenic
936166616 2:110126169-110126191 CTGGGGTTTTTATTTATTTGAGG - Intronic
937722294 2:125115955-125115977 TTGTGGCTCTAATTGTTTTGTGG - Intergenic
939543872 2:143528271-143528293 GTGGGGCTTAACTTGCTGTGTGG - Intronic
941878203 2:170456170-170456192 GTGGGGCGGTAAATGATTTTAGG + Intronic
942282245 2:174377300-174377322 TTGGGGCTTTATTTCCTTTGAGG + Intronic
942390820 2:175491345-175491367 GAGGGTCATTAATTGATTTTAGG + Intergenic
943724602 2:191240091-191240113 ATGGGTCTATAATTTATTTGTGG + Intergenic
945819201 2:214642779-214642801 GTGGAGTTTTACCTGATTTGTGG - Intergenic
1168932194 20:1632807-1632829 GTGGTGATTTAATTGACTTGAGG - Intronic
1173045810 20:39510051-39510073 GTGGGGATTACATTGATTTTTGG - Intergenic
1173276099 20:41584859-41584881 GTGGAAGTTTAATTGATTTGAGG - Intronic
1174739831 20:53001661-53001683 GTGGGGCTTTATTTAGTCTGGGG - Intronic
1176606629 21:8839464-8839486 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
1177901703 21:26925112-26925134 ATGGGGATTTAATTGGTCTGAGG - Intronic
1180356702 22:11849166-11849188 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
1180381559 22:12143165-12143187 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
1181408315 22:22700866-22700888 GTGGGGCTCTACTTTATTTCTGG - Intergenic
1183294551 22:37021946-37021968 GTGGGGTTTACATTGATTTGGGG + Intronic
949517775 3:4822582-4822604 GTAGAGCTTTCATTGATTTGGGG + Intronic
953493013 3:43365697-43365719 GTGGTGCTTGAATTGGCTTGAGG + Intronic
953521832 3:43650154-43650176 GTGGGGGTTTTATTGAGTGGTGG + Intronic
955749015 3:62168874-62168896 GTGGGGGTTTTATTGAGTGGCGG + Intronic
957957516 3:87207694-87207716 GTGGGGCTTGTATTGATTCATGG - Intergenic
960508959 3:118525571-118525593 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
963962495 3:151324531-151324553 ATGGGGCTTTAATTGAGACGTGG - Intronic
966016236 3:175140990-175141012 GTGGGGTTTTAATTGACTATGGG + Intronic
970323261 4:14896745-14896767 GTGAGACTTTTATTGCTTTGAGG + Intergenic
970875318 4:20862309-20862331 GTAGGGTCTTAATTGATTTTTGG + Intronic
970959482 4:21856308-21856330 ATGGGGATTAAATTTATTTGAGG + Intronic
971502049 4:27328322-27328344 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
973371483 4:49251693-49251715 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
973389525 4:49543618-49543640 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
974630462 4:64481141-64481163 ATGGGGACTTAATTGATTTTTGG + Intergenic
975188368 4:71430560-71430582 TTTGGGCTTCAATTAATTTGAGG - Intronic
975965127 4:79964215-79964237 TTGGAGATTTAATTGGTTTGTGG + Intronic
977908655 4:102505204-102505226 GTCAGGCTTTAAATTATTTGAGG - Intronic
979392266 4:120141187-120141209 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
979712030 4:123791099-123791121 GTGGAGATTTAATGGATCTGAGG + Intergenic
980113434 4:128656674-128656696 GGGGGACTTAAAATGATTTGGGG + Intergenic
983064337 4:163191759-163191781 GAGGGGCTTTAAGTGTGTTGAGG + Intergenic
984200013 4:176707440-176707462 GTGTAGCTTTTATTGAATTGTGG + Intronic
984597753 4:181689990-181690012 GTGCGGTTTCAATTGATTTCAGG + Intergenic
986167221 5:5285033-5285055 GTCAGCCTTTACTTGATTTGGGG + Intronic
986250049 5:6047097-6047119 ATGTGTCTTTAATTGATCTGTGG + Intergenic
988512342 5:31875724-31875746 CTGGATTTTTAATTGATTTGGGG - Intronic
988922835 5:35960766-35960788 GTGGGGGTTTTATTGAGTGGTGG + Intronic
989032516 5:37134266-37134288 CTGGGGCTTTTATTGGTTGGTGG + Intronic
989864596 5:46434076-46434098 GTGGATCTTTTAGTGATTTGAGG - Intergenic
989868116 5:46545320-46545342 GTGGATCTTTTAGTGATTTGAGG + Intergenic
991082324 5:62614857-62614879 GTGGGGGTTTTATTGACTGGTGG + Intronic
991308559 5:65209647-65209669 TTTGGGCTTTAATTGAGTTTGGG - Intronic
991449265 5:66734246-66734268 GGGGGGCTTTTAGTGACTTGTGG + Intronic
994815805 5:104586398-104586420 GAGGGGTTTTAATTTAATTGAGG + Intergenic
998822509 5:146069368-146069390 GAGGGCTTTTAAGTGATTTGGGG + Intronic
999280970 5:150365710-150365732 TTGGGGCTTTTTTTGATATGAGG + Intronic
1000276646 5:159742598-159742620 ATGGGCCTTTTATTGAGTTGAGG - Intergenic
1003593149 6:7452758-7452780 GTGGGGCTTTTATTGAGTGGTGG - Intergenic
1005102640 6:22189788-22189810 GAGGGACTTTAATTCATTGGGGG - Intergenic
1006972813 6:38064237-38064259 TGGTGGCTTGAATTGATTTGTGG - Intronic
1007262203 6:40571734-40571756 GTGGGGCATCACATGATTTGGGG - Intronic
1007326855 6:41068796-41068818 ATGGAGATTTAATTGATTGGTGG - Intronic
1008280399 6:49589161-49589183 AAGGAGGTTTAATTGATTTGTGG - Intergenic
1009192169 6:60642275-60642297 GTGGAGGTTAAATTGCTTTGTGG + Intergenic
1009315883 6:62220972-62220994 GTGGTGATTTAATTTCTTTGGGG - Intronic
1011315861 6:86030493-86030515 GTGGGGCTTCATTTGAGTTGAGG - Intergenic
1017751599 6:157493990-157494012 GTGGGGCTTTATGTGGCTTGGGG + Intronic
1020632210 7:10652861-10652883 ATGGGGCTTTTAATGTTTTGGGG + Intergenic
1024167022 7:46745469-46745491 GTGTGGCCTTAAATGAATTGTGG + Intronic
1030117619 7:106074149-106074171 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
1035927263 8:3741749-3741771 GTGGTGGTTGAATTTATTTGTGG + Intronic
1041621160 8:59970951-59970973 GTGAGCCTTCAGTTGATTTGAGG - Intergenic
1042434757 8:68750468-68750490 GTGAGTATTTAATGGATTTGAGG + Intronic
1042554717 8:70024194-70024216 ATGGGGCTTGAATTCATTTTTGG - Intergenic
1042937383 8:74073599-74073621 GTTGGCCCTTAATTGATTAGGGG + Intergenic
1043486855 8:80706200-80706222 TTGGGGCTTAAGTGGATTTGAGG - Intronic
1043503562 8:80880002-80880024 GTGGGGCTTTAAGTGATGTGTGG + Intergenic
1043630843 8:82330833-82330855 GTGGGTCTTTTATTGTTTTACGG - Intergenic
1046541607 8:115590831-115590853 GAGGGGCTTTATTTAATTTTAGG - Intronic
1046949261 8:120004093-120004115 GTGGTGTTTTCATTGAGTTGGGG - Intronic
1050650566 9:7771339-7771361 GTGGAGCTGGAATTGACTTGGGG + Intergenic
1050981175 9:12017943-12017965 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
1052459757 9:28747363-28747385 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
1055166167 9:73197034-73197056 CTGGGGCTTAAATTGATTCTTGG + Intergenic
1056683764 9:88742789-88742811 GTGGGGCTTTAAGTGTTTTTTGG - Intergenic
1057445003 9:95107622-95107644 GTGGGGCTTTAATTGATTTGTGG - Intronic
1058656299 9:107224160-107224182 GAGGAGCTGTAATAGATTTGGGG + Intergenic
1059000857 9:110347485-110347507 GTGTTTCTTTAATTGAATTGAGG + Intergenic
1060150615 9:121285966-121285988 GTTGGGTTTTAATTGTGTTGAGG + Intronic
1203695920 Un_GL000214v1:96761-96783 GTGGGGGTTTTATTGAGTGGTGG - Intergenic
1203741764 Un_GL000218v1:9679-9701 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
1203553937 Un_KI270743v1:190324-190346 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
1203640353 Un_KI270751v1:7302-7324 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
1187171786 X:16859317-16859339 GTGGGTTTCTGATTGATTTGAGG - Intronic
1192920937 X:75705473-75705495 GTGTGGCTCTTATTGTTTTGAGG - Intergenic
1194019084 X:88665501-88665523 ATAGGGCTTTTATTGTTTTGAGG + Intergenic
1194959335 X:100216940-100216962 GTGGTGCTTTAATTGAGTTCAGG + Intergenic
1199323383 X:146468127-146468149 GTGGGGTTTTGTTTGTTTTGAGG - Intergenic
1199903532 X:152201545-152201567 ATGGCCCTTTAAGTGATTTGGGG + Intronic
1200968874 Y:9128482-9128504 GTGGGGCTTTACTTTCTCTGTGG - Intergenic
1201155296 Y:11127133-11127155 GTGGGGGTTTTATTGAGTGGTGG + Intergenic
1201581897 Y:15518427-15518449 GTGGGGCTCTGGTTGATTTATGG - Intergenic