ID: 1057445004

View in Genome Browser
Species Human (GRCh38)
Location 9:95107639-95107661
Sequence GGCGGAGGTCTGACTGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057445004_1057445011 4 Left 1057445004 9:95107639-95107661 CCCCACGCAGTCAGACCTCCGCC 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data
1057445004_1057445014 30 Left 1057445004 9:95107639-95107661 CCCCACGCAGTCAGACCTCCGCC 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1057445014 9:95107692-95107714 GCCTTTGCTTCTTGCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057445004 Original CRISPR GGCGGAGGTCTGACTGCGTG GGG (reversed) Intronic
900240097 1:1612483-1612505 GGTGGAGGGCTGGCTGGGTGTGG + Intergenic
900615712 1:3564827-3564849 AGGGGAGGTCTGTCTGTGTGAGG - Intronic
900959334 1:5909284-5909306 TGTGGAGACCTGACTGCGTGGGG - Intronic
903679745 1:25089035-25089057 GGCGGAGGCCTGAGGGAGTGAGG + Intergenic
904299216 1:29543305-29543327 TGCTGTGGTCTGAATGCGTGTGG + Intergenic
905202557 1:36323833-36323855 GCTGGAGCTCTGCCTGCGTGCGG + Exonic
907443155 1:54490601-54490623 GGCGCAGAGCTGACTGCGGGAGG + Intergenic
910478507 1:87634104-87634126 GTCGGTGGTCTGCCAGCGTGTGG + Intergenic
920284875 1:204872161-204872183 GGGTGAGGTCTGACTGCCTCTGG - Intronic
1070787523 10:79170613-79170635 GGCGGAGGCCAGAGTGGGTGGGG + Intronic
1072197361 10:93128039-93128061 GGCGCCGGGCTGACTGCCTGTGG - Intergenic
1076072668 10:127503993-127504015 GACTGAGGTATGACTGTGTGAGG - Intergenic
1076635521 10:131879958-131879980 GAAGGAGGTGTGCCTGCGTGTGG + Intergenic
1078011646 11:7576932-7576954 GGCGGGGGTCAGGCTGTGTGTGG + Intronic
1085645817 11:78221859-78221881 GGCTGAGGTCTGGGTGTGTGAGG - Intronic
1085689871 11:78656162-78656184 TGAGAAGGTCTGACTGCATGAGG - Exonic
1092206030 12:6614501-6614523 GGCAGAGCTCTGTCTGGGTGAGG + Intergenic
1099622911 12:85026649-85026671 TGGGGAGGTCTGACTGCCTCAGG + Intronic
1108773224 13:53731066-53731088 GGCCCAGGTCTGAGTGAGTGTGG - Intergenic
1110953347 13:81521888-81521910 GGCAGAGGACTGATTGCTTGGGG - Intergenic
1112112247 13:96314130-96314152 GGCGGAGGTCTCAGTGAGTCAGG + Intronic
1113532536 13:111039052-111039074 GGCTGAGGTCTGACCTCCTGGGG + Intergenic
1128092649 15:64929491-64929513 TGCTGAGGTCAGCCTGCGTGGGG - Intronic
1132607661 16:800282-800304 GGCGCAGGACTAGCTGCGTGCGG + Intronic
1143115648 17:4580538-4580560 CACGGAGGTCTCACTGTGTGGGG - Intergenic
1143618689 17:8068899-8068921 GGCGCAGGGCTGCCTGCCTGTGG + Intergenic
1147300134 17:39519827-39519849 GGCCAAGGTAGGACTGCGTGAGG - Intronic
1147988681 17:44320571-44320593 AGCGGAGGTCTCCCTGCGGGGGG - Intronic
1148578453 17:48727311-48727333 GGCAAAGGCCTGACTGTGTGTGG - Intronic
1151327982 17:73390607-73390629 GGCTGTGGTCTGTCTGCCTGAGG + Intronic
1152525102 17:80884029-80884051 GGCAGAGGTCTGCTCGCGTGCGG + Intronic
1152718837 17:81912654-81912676 GGGGCAGGTGTGACTGCGAGAGG - Intronic
1157342462 18:46791613-46791635 GGGGGAGCTCTGTCTGCCTGAGG - Intergenic
1157386396 18:47262470-47262492 GGCGGCGGTCTGCGCGCGTGTGG - Intergenic
1160198163 18:76774223-76774245 GGTCGAGGTCAGACTGCATGAGG - Intergenic
1162974058 19:14198314-14198336 GGTGGAGATCAGACTGTGTGTGG + Intronic
1165488747 19:36111144-36111166 GGCTGAGGTCTGACAGCAGGTGG + Intergenic
1165749471 19:38251386-38251408 GGCGGAGGCCGGGCTGCCTGTGG + Exonic
1165767975 19:38362555-38362577 GACCGAGTTCTGACTGCGTCCGG - Exonic
1167723950 19:51198699-51198721 GGATGAGCTCTGACTGTGTGAGG + Intergenic
925091129 2:1156772-1156794 GGCTGAGCCCTGCCTGCGTGGGG + Intronic
927939916 2:27097088-27097110 GGCGGATGTCTGACTGCTTAGGG + Intronic
930043362 2:47146721-47146743 AGCAGAGGTCTGAGTGCTTGGGG + Intronic
931792290 2:65674723-65674745 GGGGGAGGTCTGACTGGCAGAGG + Intergenic
932576884 2:72967482-72967504 GGCAGAGGCCTGACTGAGAGAGG + Intronic
937926454 2:127171337-127171359 GGCGCAGGGCTGTCTGCCTGTGG - Intergenic
944461486 2:199955139-199955161 GGCGGAGAGCTGAGTGCGAGAGG - Intronic
947501405 2:230673975-230673997 GGCGCCGGGCTGACTGCTTGTGG - Intergenic
1169120422 20:3092726-3092748 CGCGGGTGTCTGGCTGCGTGGGG - Intergenic
1170673402 20:18455854-18455876 GGAGGAAGTCTGACTACCTGAGG - Intronic
1170792072 20:19516684-19516706 CGTGGAAGTCTGACTGCCTGAGG - Intronic
1171823478 20:29875564-29875586 GGCGCAGGGCTGTCTGCCTGTGG + Intergenic
1171896617 20:30814763-30814785 GGCGCAGGGCTGTCTGCCTGTGG - Intergenic
1173688514 20:44940840-44940862 GGTGGAGGACAGACTGCGGGAGG - Intronic
1174358617 20:50014523-50014545 GGAGGAGGTGGGACAGCGTGTGG + Intergenic
1175262036 20:57680902-57680924 GGCGGAGAGCAGTCTGCGTGAGG + Intronic
1176112898 20:63418574-63418596 GGCTGAGGTCAGGCTGCTTGGGG - Intronic
1178295828 21:31409396-31409418 GGAGAAGGTCTGGCTGGGTGTGG - Intronic
1183642765 22:39102096-39102118 GGCAGAGGTGTGACTGGGTATGG - Intronic
1184260038 22:43309709-43309731 GGGGGAGGACAGACTGGGTGTGG - Intronic
953333627 3:42075183-42075205 GGATGAGGTCTGGCTGGGTGTGG + Intronic
968177212 3:196561366-196561388 GGCGGAGATCTCACGGCTTGGGG - Exonic
968597927 4:1494938-1494960 GGCGGAGCTCTGACTGTGTGAGG + Intergenic
973635824 4:52861591-52861613 GAAGGAGGTGTGACTGAGTGAGG + Intergenic
985148903 4:186925586-186925608 GGCTGATTTCTGACTGCATGGGG + Intergenic
997278515 5:132620693-132620715 TGTGGATTTCTGACTGCGTGGGG - Intronic
997694867 5:135852700-135852722 GGAGCAGGTCTGACAGCGTGCGG - Exonic
1001054953 5:168441702-168441724 GGCGGAGGTCTGCCGGTCTGGGG + Exonic
1006252294 6:32797892-32797914 GGCGGAGGCCTGACATGGTGAGG + Intergenic
1006517814 6:34554561-34554583 GGAGGTGGTCTCACTGCGTAGGG - Intronic
1013030271 6:106325825-106325847 GGCGGAGTTCGGACCACGTGGGG - Intergenic
1015274782 6:131372919-131372941 GGAGGAGATCTGACTGGCTGGGG + Intergenic
1016467213 6:144337574-144337596 GTCTGAGGTCTGGCTCCGTGTGG + Intronic
1018915262 6:168129038-168129060 GTGGGAAGTCTGACTGCCTGGGG - Intergenic
1023513711 7:40979528-40979550 TGCGGAGGCCTGACTGCATCTGG + Intergenic
1024604525 7:51013024-51013046 GGCTGAGCCCTGTCTGCGTGTGG - Intergenic
1029581168 7:101437414-101437436 GGCGGAGTTCTGAATGCTGGTGG + Intronic
1029581176 7:101437449-101437471 GGCGGAGTTCTGAATGGGGGCGG + Intronic
1034199937 7:149278048-149278070 GGAGGAGGCCCGACTGCGGGAGG + Intronic
1035553023 8:544688-544710 GGAGGAGGACGGCCTGCGTGGGG - Exonic
1035666232 8:1382049-1382071 TGCGGATTTCTGACTGCATGAGG - Intergenic
1038373525 8:27015260-27015282 AGAGGAGGCCTGACTGGGTGTGG + Intergenic
1041515034 8:58690948-58690970 GGCGCAGGGCTGTCTGCTTGTGG - Intergenic
1044621875 8:94198656-94198678 GGTGGAGGTGTGACTGGGTGTGG - Intronic
1049239161 8:141528168-141528190 GGAGGAGGTGTGCCAGCGTGAGG - Intergenic
1053269364 9:36739707-36739729 GACGGAGGCCTGACAGCGCGCGG + Intergenic
1057445004 9:95107639-95107661 GGCGGAGGTCTGACTGCGTGGGG - Intronic
1059301290 9:113315542-113315564 GGCTGAGGTCTGACTCCTGGGGG + Exonic
1060155054 9:121313803-121313825 GGAGGAGGTCAGACTCCATGGGG + Intronic
1203376547 Un_KI270442v1:382079-382101 GGCGCAGGTCTGTCTGCCTGTGG + Intergenic
1186388734 X:9136794-9136816 GGCAGAGGGCAGACTGGGTGGGG + Intronic
1186433365 X:9523233-9523255 GGCAGAGGCCAGACTGCATGCGG - Intronic
1189254883 X:39630096-39630118 GTGGGAGGTCTGACTGCCAGAGG + Intergenic
1193793443 X:85844428-85844450 GACGGAGGTGTGATTGCTTGAGG + Intergenic
1197590831 X:128408004-128408026 GGCTGAGTTCTGACTCCGGGAGG + Intergenic
1199364044 X:146957518-146957540 CGATGAGGTCTGACTGCCTGTGG + Intergenic