ID: 1057445005

View in Genome Browser
Species Human (GRCh38)
Location 9:95107640-95107662
Sequence CGGCGGAGGTCTGACTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057445005_1057445014 29 Left 1057445005 9:95107640-95107662 CCCACGCAGTCAGACCTCCGCCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1057445014 9:95107692-95107714 GCCTTTGCTTCTTGCTATATTGG No data
1057445005_1057445016 30 Left 1057445005 9:95107640-95107662 CCCACGCAGTCAGACCTCCGCCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1057445016 9:95107693-95107715 CCTTTGCTTCTTGCTATATTGGG No data
1057445005_1057445011 3 Left 1057445005 9:95107640-95107662 CCCACGCAGTCAGACCTCCGCCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057445005 Original CRISPR CGGCGGAGGTCTGACTGCGT GGG (reversed) Intronic
900186712 1:1336321-1336343 TAGCCGAGGCCTGACTGCGTGGG + Exonic
900959335 1:5909285-5909307 CTGTGGAGACCTGACTGCGTGGG - Intronic
905453556 1:38072548-38072570 CAGTGGAGGTCTGAGTGGGTAGG + Intergenic
912798503 1:112706894-112706916 GGGCGGTGGTCGGACCGCGTCGG - Intronic
924707547 1:246511830-246511852 AGGGGGAGGTCTGGCTGGGTGGG - Intergenic
1066145508 10:32553960-32553982 TGGCTGAGGTCTGACTCCTTGGG + Intronic
1078407219 11:11080915-11080937 CAGCTGAGGTCTGGCTGCCTTGG + Intergenic
1096674918 12:53221202-53221224 CGGCGGAGGGCGGACTGCTCGGG - Intronic
1097787810 12:63780122-63780144 CGGCCGAGGTAGGACTGGGTCGG + Exonic
1124696663 15:31870010-31870032 CACCGGAGCTGTGACTGCGTGGG - Intronic
1125550262 15:40539640-40539662 CAGCGGAGAGCTGACTGCCTTGG - Intronic
1128092650 15:64929492-64929514 CTGCTGAGGTCAGCCTGCGTGGG - Intronic
1130905206 15:88235348-88235370 CGGCAGGGTACTGACTGCGTGGG - Intronic
1133317474 16:4893437-4893459 CGGCGGGGGGCTGGCTGCCTAGG - Intronic
1134798492 16:17063201-17063223 TGGCGTATTTCTGACTGCGTGGG + Intergenic
1142822119 17:2477846-2477868 CGTCAGAGCTCTGACTGCTTCGG + Exonic
1143115649 17:4580539-4580561 CCACGGAGGTCTCACTGTGTGGG - Intergenic
1146062875 17:29616162-29616184 TGGAAGAGGTCTGACTGCGGGGG + Exonic
1147988682 17:44320572-44320594 CAGCGGAGGTCTCCCTGCGGGGG - Intronic
1165371374 19:35408473-35408495 CGGCGGGGGTCTCACTGTCTGGG + Intergenic
927884104 2:26707931-26707953 GGGTGGAGGAATGACTGCGTGGG - Intronic
927939915 2:27097087-27097109 TGGCGGATGTCTGACTGCTTAGG + Intronic
936348909 2:111697701-111697723 CGGAGGGGGTGTGACTGCGGAGG + Intergenic
948632225 2:239309672-239309694 TGGCGGAGCTCTGCCTGCGGTGG - Intronic
1169120423 20:3092727-3092749 CCGCGGGTGTCTGGCTGCGTGGG - Intergenic
1176167891 20:63683671-63683693 CGGCGGGGCTCTGACGGCGGTGG + Intronic
954361974 3:50126852-50126874 AGGGGGAGGCCTGACTGTGTAGG + Intergenic
982127431 4:152196571-152196593 CTGAGGAGGCCTGACTGTGTTGG - Intergenic
1005897460 6:30190358-30190380 CGGCAGAGGCCAGACTGCGCAGG + Intronic
1006517815 6:34554562-34554584 AGGAGGTGGTCTCACTGCGTAGG - Intronic
1013737488 6:113244665-113244687 CAGCGGAGGCCTTACTGCATGGG + Intergenic
1039608535 8:38901534-38901556 CGGCGGAGGCCTGGCGGCCTAGG + Intronic
1049419643 8:142511066-142511088 CGGCCGGGGTCTCACCGCGTCGG - Exonic
1057445005 9:95107640-95107662 CGGCGGAGGTCTGACTGCGTGGG - Intronic