ID: 1057445006

View in Genome Browser
Species Human (GRCh38)
Location 9:95107641-95107663
Sequence TCGGCGGAGGTCTGACTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057445006_1057445014 28 Left 1057445006 9:95107641-95107663 CCACGCAGTCAGACCTCCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 26
Right 1057445014 9:95107692-95107714 GCCTTTGCTTCTTGCTATATTGG No data
1057445006_1057445016 29 Left 1057445006 9:95107641-95107663 CCACGCAGTCAGACCTCCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 26
Right 1057445016 9:95107693-95107715 CCTTTGCTTCTTGCTATATTGGG No data
1057445006_1057445017 30 Left 1057445006 9:95107641-95107663 CCACGCAGTCAGACCTCCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 26
Right 1057445017 9:95107694-95107716 CTTTGCTTCTTGCTATATTGGGG No data
1057445006_1057445011 2 Left 1057445006 9:95107641-95107663 CCACGCAGTCAGACCTCCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 26
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057445006 Original CRISPR TCGGCGGAGGTCTGACTGCG TGG (reversed) Intronic
903708915 1:25307253-25307275 TTGGCTGAGGTCTCACTGCGAGG + Intronic
903718204 1:25385165-25385187 TCGGCTGAGGTCTCACTGTGAGG - Intronic
904620182 1:31770513-31770535 TCGGTGGGGGTCTGACTCCCAGG + Intergenic
920729898 1:208473673-208473695 TTGGCAGAGGTCTGAGTGCCAGG + Intergenic
920861432 1:209711088-209711110 TCAGTGGAGGTCTGCCTGTGTGG + Intronic
922572344 1:226641676-226641698 TCGGCAGAGGGCTGACAGCTGGG + Intronic
1071712113 10:88060196-88060218 TAGGCTGAGGTCTGACAGCTGGG - Intergenic
1081563896 11:44244297-44244319 TTGGTGGAGGTCTGAATGTGAGG + Exonic
1096674919 12:53221203-53221225 GCGGCGGAGGGCGGACTGCTCGG - Intronic
1098602004 12:72343080-72343102 TAGGCTGAAGTCTGACTGCCTGG - Intronic
1103937069 12:124482465-124482487 TGGGTGGTGGTCTGGCTGCGGGG - Intronic
1131068538 15:89449431-89449453 CCGACTGAGGTCTGACTGCTGGG - Intergenic
1132624090 16:881897-881919 TCGGCTGAGCTCTGACGGGGAGG + Intronic
1143635583 17:8162416-8162438 TGGGCGGAGCCCTGGCTGCGGGG - Intronic
1146062874 17:29616161-29616183 CTGGAAGAGGTCTGACTGCGGGG + Exonic
1147988683 17:44320573-44320595 CCAGCGGAGGTCTCCCTGCGGGG - Intronic
1152734282 17:81989517-81989539 TCGGAGGAGGTCTGAGTCCAGGG + Intronic
1157296722 18:46450362-46450384 ACGGCGGAGGTGTGTCTGCTGGG - Exonic
1160859081 19:1230155-1230177 TCGGCGGGGCTCTGACGGCGCGG - Exonic
1161777902 19:6273813-6273835 TCGGCCGAGGTCTGAGTGGCCGG - Intronic
927884105 2:26707932-26707954 TGGGTGGAGGAATGACTGCGTGG - Intronic
929826248 2:45311257-45311279 TCGGGGGAGGACGGACTGAGGGG - Intergenic
940255691 2:151726542-151726564 TGGGCTGAGGTCTCACTGGGTGG - Intronic
946413606 2:219527963-219527985 TCGGCGGAGCCCTGACTGCCAGG - Intronic
1181001466 22:19989668-19989690 TGGGGGGAGGTCTGGCTGCTGGG + Intronic
959085936 3:101850158-101850180 TCGGCCGAGCTCTGACTGCCGGG + Intronic
970001318 4:11368753-11368775 GCGGCGGTGGTCTGGCAGCGCGG + Intergenic
1047405248 8:124579842-124579864 TCCTGGGAGGTCTGTCTGCGAGG - Intronic
1049518438 8:143074828-143074850 TCGGCAGAGCTCTACCTGCGGGG - Intergenic
1057445006 9:95107641-95107663 TCGGCGGAGGTCTGACTGCGTGG - Intronic
1059978116 9:119739412-119739434 TCAGAGGAGGTCTGACTGTGTGG + Intergenic
1061540121 9:131273778-131273800 TTGGCGCAGGGCTGACTGCATGG + Intronic
1189320359 X:40083715-40083737 TCGGCGGAGGTCCCAGCGCGCGG + Intronic