ID: 1057445011

View in Genome Browser
Species Human (GRCh38)
Location 9:95107666-95107688
Sequence CAGTGTTCCCATACGAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057445004_1057445011 4 Left 1057445004 9:95107639-95107661 CCCCACGCAGTCAGACCTCCGCC 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data
1057445003_1057445011 21 Left 1057445003 9:95107622-95107644 CCACAAATCAATTAAAGCCCCAC 0: 1
1: 0
2: 4
3: 12
4: 152
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data
1057445005_1057445011 3 Left 1057445005 9:95107640-95107662 CCCACGCAGTCAGACCTCCGCCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data
1057445006_1057445011 2 Left 1057445006 9:95107641-95107663 CCACGCAGTCAGACCTCCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 26
Right 1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057445011 Original CRISPR CAGTGTTCCCATACGAATGT AGG Intronic
No off target data available for this crispr