ID: 1057447099

View in Genome Browser
Species Human (GRCh38)
Location 9:95124225-95124247
Sequence AAACTGCGGAGAGCTTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057447094_1057447099 7 Left 1057447094 9:95124195-95124217 CCAAGCATTGTAGTTCTCCTCTC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1057447099 9:95124225-95124247 AAACTGCGGAGAGCTTCACAGGG No data
1057447097_1057447099 -10 Left 1057447097 9:95124212-95124234 CCTCTCGGAAGTCAAACTGCGGA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1057447099 9:95124225-95124247 AAACTGCGGAGAGCTTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057447099 Original CRISPR AAACTGCGGAGAGCTTCACA GGG Intronic
No off target data available for this crispr