ID: 1057450625

View in Genome Browser
Species Human (GRCh38)
Location 9:95155645-95155667
Sequence CAGAGGTTTTTAAAGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057450623_1057450625 2 Left 1057450623 9:95155620-95155642 CCTTGGACAGAAGACAAGCAGTT 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1057450625 9:95155645-95155667 CAGAGGTTTTTAAAGTCTCCTGG No data
1057450622_1057450625 3 Left 1057450622 9:95155619-95155641 CCCTTGGACAGAAGACAAGCAGT 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1057450625 9:95155645-95155667 CAGAGGTTTTTAAAGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057450625 Original CRISPR CAGAGGTTTTTAAAGTCTCC TGG Intronic
No off target data available for this crispr