ID: 1057453893

View in Genome Browser
Species Human (GRCh38)
Location 9:95190282-95190304
Sequence GACGCGGGTCACTGCTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057453893 Original CRISPR GACGCGGGTCACTGCTGCGG AGG (reversed) Intronic
900297654 1:1960053-1960075 CACGGGGGTTAGTGCTGCGGAGG + Intronic
901057201 1:6454173-6454195 GTCGCTGGTCGCTGCTGCGGCGG - Intronic
902402866 1:16167592-16167614 GACGCGGGCCAGGGGTGCGGTGG + Intergenic
903173012 1:21565201-21565223 GACGTGGGTCTCTACTGTGGAGG - Intronic
907342652 1:53747936-53747958 CACGAGGGCCACTGCTGTGGTGG - Intergenic
909931160 1:81502002-81502024 CACTTGGGCCACTGCTGCGGTGG - Intronic
910436048 1:87207347-87207369 GACTAGGGTCACTGCTGCCTAGG - Intergenic
922424111 1:225478116-225478138 GAAGCGGGAGGCTGCTGCGGAGG + Intergenic
924778364 1:247126682-247126704 GACCCGGGTCCCTGCTGGCGCGG + Intronic
924783294 1:247171738-247171760 GACCCGGGTCCCTGCTGGCGCGG - Intronic
1070727669 10:78803252-78803274 GCCACGGGGCCCTGCTGCGGGGG + Intergenic
1075443117 10:122494825-122494847 GACGGGGGTCACTGCGGGTGAGG + Intronic
1076770402 10:132659746-132659768 GACTCGGGACAGTGCTGGGGAGG - Intronic
1076791109 10:132777148-132777170 GCCCCGGGTCACTGCTGCAGTGG - Intronic
1077074645 11:694846-694868 GCCGCGGGTCACGGCAGTGGCGG - Exonic
1077367414 11:2166780-2166802 CACGCGGGTCACTGCCGAGCCGG + Intronic
1078638684 11:13075804-13075826 GATGGGGGTCACTGGTGCTGAGG - Intergenic
1083632730 11:64104123-64104145 GACTGGGGTCACTGGTCCGGAGG - Exonic
1087008874 11:93494971-93494993 GAGGAGGGTCGCTGCTGTGGTGG - Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101863348 12:108500465-108500487 GCCACGGCTCACTCCTGCGGTGG - Intergenic
1103563651 12:121804928-121804950 GACGCGGGGCACGGCTGGGGGGG - Intronic
1115331849 14:32206211-32206233 GACGCCGGTCATTGATGCTGTGG - Intergenic
1119610099 14:76054506-76054528 GACGCTGGGCACTGCAGCTGTGG - Intronic
1121011715 14:90523833-90523855 GCCTCGGCCCACTGCTGCGGTGG - Intergenic
1122015856 14:98796108-98796130 GACACTGGACAGTGCTGCGGAGG - Intergenic
1129288408 15:74544157-74544179 CACTTGGGCCACTGCTGCGGTGG - Exonic
1132208566 15:100003333-100003355 TACGAGGCTCACTGCTGCAGAGG + Intronic
1132628458 16:903850-903872 GACGCCTGTCTCTGCTGCGTGGG + Intronic
1132628540 16:904359-904381 GACGCCTGTCTCTGCTGCGTGGG + Intronic
1132628597 16:904683-904705 GACGCCTGTCTCTGCTGCGTGGG + Intronic
1132628638 16:904914-904936 GACGCCTGTCTCTGCTGCGTGGG + Intronic
1136519436 16:30786651-30786673 GACGGGGGTCGCGGCTCCGGGGG - Intronic
1142595886 17:1029798-1029820 GACACGGGTCAGCGCTGTGGTGG - Intronic
1146530678 17:33605244-33605266 GAAGCGGGTCTCTGCTGCAGCGG + Intronic
1151808233 17:76420082-76420104 GAAGGGGGCCACTGCTGCGCTGG - Intronic
1155570158 18:27184648-27184670 GACGAGCATCTCTGCTGCGGGGG - Intronic
1158814778 18:61082683-61082705 CACGCGGGTCACTTCTGGGCTGG - Intergenic
1159801046 18:72899549-72899571 GAGGCAGCTCACTGCTGCTGAGG - Intergenic
1161003449 19:1922842-1922864 CACGCGGCTCACTGCTGCGATGG + Intronic
1161620111 19:5293189-5293211 GACGCGGGGAGCGGCTGCGGCGG - Intronic
927146139 2:20167895-20167917 AATGCTGGTCACAGCTGCGGTGG - Intergenic
936494427 2:113005725-113005747 GACTGGGGTCACTGCTGGGCTGG + Exonic
937221664 2:120345900-120345922 GTCGCGGGTCACTGCCGCACGGG - Intergenic
938365033 2:130727643-130727665 GACGCGGTTCCGGGCTGCGGCGG + Intergenic
938717576 2:134035036-134035058 GACGCTGGTCACTGCAGCAGTGG + Intergenic
941384896 2:164841233-164841255 GCGGCGCGTCACTGCTGGGGTGG + Exonic
945683408 2:212939706-212939728 AACGCTGGTCACTGCTGCAAAGG - Intergenic
948272165 2:236683138-236683160 GACTCGGATCACTGCTGCTCAGG + Intergenic
1169193985 20:3673704-3673726 GACGCGGGTCCCGGGTGGGGCGG - Intronic
1170889239 20:20364877-20364899 GAAGCGGGGAACTTCTGCGGAGG - Intergenic
1171100188 20:22375565-22375587 AACACAGGTCTCTGCTGCGGCGG + Intergenic
1174653775 20:52152626-52152648 GACGATGTTCACTGCAGCGGCGG + Exonic
1181051020 22:20238309-20238331 GGGGCGGGCCACTGCGGCGGCGG - Intergenic
1181582680 22:23836861-23836883 GGTGGGGGTCACTGCTGCGGGGG + Intronic
1184174160 22:42777297-42777319 GACGCGGGTCTCTGTTCCGCTGG - Intergenic
1185414932 22:50704729-50704751 GATGGGGGTCTCTGCTGCGGGGG - Intergenic
950117374 3:10460135-10460157 GACGGAGGTCAGTGCTGGGGAGG + Intronic
952287290 3:31981197-31981219 GACGCGGGTGCCCGCCGCGGTGG + Exonic
956015265 3:64875707-64875729 GACTCAGGTCTCTGCTGCTGGGG - Intergenic
961316510 3:126039544-126039566 GACCCAGGTCACTGCTGAGGTGG + Intronic
967987067 3:195103301-195103323 GACGCAGGTCGCTGGTGTGGGGG - Intronic
968886206 4:3334840-3334862 GATGCGGGTCACTGATGTGTTGG + Intronic
970840402 4:20461979-20462001 GACTGGGGACACTGCTGGGGTGG + Intronic
976009644 4:80471875-80471897 GCCGCGGGTCAGTGCTGCCAAGG - Intronic
981079318 4:140622819-140622841 GAGGCTGGTCACTGCTGCCGTGG + Exonic
983562673 4:169116584-169116606 GATGGGTGTCACTGCTGCCGTGG + Exonic
985765838 5:1779161-1779183 GACCAGGGTCACTGCCCCGGTGG + Intergenic
999178188 5:149646931-149646953 GACGCGGGTGGGGGCTGCGGTGG + Intergenic
1002081746 5:176741510-176741532 GTCGTGGGTCACTGCTGATGGGG + Intergenic
1003591497 6:7440912-7440934 GACCAGGGGCACAGCTGCGGGGG - Intergenic
1008478329 6:51957602-51957624 GACGGGGTTCACTGATGGGGTGG + Intronic
1026189020 7:68107591-68107613 GTCGCCGGTCACAGCTGCTGTGG + Intergenic
1030138859 7:106285066-106285088 GGCGCGGGTGACGGCTGCGGCGG + Exonic
1032395207 7:131584448-131584470 GATGAGGGGCACTGCTGTGGTGG + Intergenic
1034673359 7:152873229-152873251 GAAGCTGGTTACTGCAGCGGTGG + Intergenic
1034916336 7:155042919-155042941 GACACATGTCACTGCTGGGGAGG + Intergenic
1042859046 8:73295042-73295064 GAGCCGGGTGACTGCCGCGGCGG + Exonic
1049230250 8:141478148-141478170 GCCCCGGGTCGCTGCTGCTGTGG - Intergenic
1053892710 9:42710804-42710826 CACGCAGGTCGCTGCTGCTGGGG + Intergenic
1054809350 9:69422405-69422427 GAAGCGGGTGTCTGCTGGGGAGG + Intergenic
1057453893 9:95190282-95190304 GACGCGGGTCACTGCTGCGGAGG - Intronic
1061285562 9:129620481-129620503 GCCGCGGGTCGCTGCTGCGTCGG + Exonic
1062530663 9:136998158-136998180 GACTCGGTTCACCGCTGCAGCGG + Intergenic
1186768050 X:12791410-12791432 GACGCGGGAGGCTGCTGCTGCGG - Exonic
1186768455 X:12794190-12794212 GAGGCTGGTCACAGCTGAGGCGG + Intronic
1192260115 X:69501130-69501152 GAGGCGGGTCACTCCTGAGGGGG - Intergenic