ID: 1057466746

View in Genome Browser
Species Human (GRCh38)
Location 9:95321148-95321170
Sequence CTGTAAATGGAGTTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057466746_1057466752 19 Left 1057466746 9:95321148-95321170 CCTGGCTTCAACTCCATTTACAG No data
Right 1057466752 9:95321190-95321212 TTCTTGCTCCTGGCCCAGGCTGG No data
1057466746_1057466750 9 Left 1057466746 9:95321148-95321170 CCTGGCTTCAACTCCATTTACAG No data
Right 1057466750 9:95321180-95321202 ACTTATAATGTTCTTGCTCCTGG No data
1057466746_1057466751 15 Left 1057466746 9:95321148-95321170 CCTGGCTTCAACTCCATTTACAG No data
Right 1057466751 9:95321186-95321208 AATGTTCTTGCTCCTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057466746 Original CRISPR CTGTAAATGGAGTTGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr